0
The 2010 Ford Taurus is 16 ft. 10.9 in. (202.9 in.) long.
What else can I help you with?
Related Questions
How long is roadside assistance included with the 2010 Ford Taurus?
The 2010 Ford Taurus includes 5 yr./ 60000 mi. of roadside assistance.
How many valves does the 2010 Ford Taurus have?
The 2010 Ford Taurus has 24 valves.
What size engine does the 2010 Ford Taurus have?
The 2010 Ford Taurus has a V6 engine.
Is the 2010 Ford Taurus electric or gas?
The 2010 Ford Taurus is a gas-powered vehicle.
What kind of transmission does the 2010 Ford Taurus have?
The 2010 Ford Taurus has a 6-speed automatic.
What is the curb weight of the 2010 Ford Taurus?
The curb weight of the 2010 Ford Taurus is 4015 lbs..
How tall is the 2010 Ford Taurus?
The height of the 2010 Ford Taurus is 5 ft. 0.7 in. (60.7 in.).
What kind of fuel does the 2010 Ford Taurus use?
The 2010 Ford Taurus runs on regular unleaded.
What is the cam type of the 2010 Ford Taurus?
The 2010 Ford Taurus has double overhead cam (DOHC).
What is the turning circle of the 2010 Ford Taurus?
The 2010 Ford Taurus's turning circle is 39.7 ft..
What is the rear shoulder room of the 2010 Ford Taurus?
The 2010 Ford Taurus has 56.9 in. of rear shoulder room.
What is the front shoulder room in the 2010 Ford Taurus?
The 2010 Ford Taurus has 57.9 in. of front shoulder room.
Trending Questions
Tattoos that represent travel?
Which of the events was most influential in bringing the US into the world war 2?
What were the elements and functions of god myths?
Give two types of evidence for continental drift with an example of each type?
When you rate their depression on a scale from 1-10. their response are what in your study?
What is the distance between the points (1 -2) and (-93) on a grid?
Why were marriages arranged in Shakespeare's time?
Why does carbon conduct electricity if it is a non metal?
What should you do if the application of one Combat Application Trouniquet does not stop bleeding?
What is minimum age of a imam?
Would mung bean grow without water?
How many amps does a one horse power motor draw?
How long will it take to run 1.5 miles at 7 miles per hour?
Is sign language a forgen language?
What language do Wales people talk?
What is a catchy title for a science fair project on heat?
What words have the same vowel sound as the word ground?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What is the common name for the spine?
How many people use health app from their cell phone?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.