0
If this stand of DNA was used, what would be the complementary DNA produced CGA CT?
GCT GA :)
What else can I help you with?
If this strand of DNA were used GTA CA what would be the complementary DNA produced?
CAT GT. -APEX Learning
If cga ct were used what would be the complimentary DNA produced?
If cga ct were used as a template strand for complementary DNA synthesis, the complementary DNA produced would be gct ga. This is because each nucleotide pairs with its complementary base: cytosine (c) pairs with guanine (g), guanine (g) pairs with cytosine (c), adenine (a) pairs with thymine (t), and thymine (t) pairs with adenine (a). Therefore, the complementary sequence would read from 5' to 3' as gct ga.
How do you use complementary colors in a sentence?
The most complementary colors for my skin tone are peachy pink and light blue.
What is a complementary line?
The phrase "complementary line" usually has to do with business. Example: I have a complementary line of famous products that I am trying to sell to you". Mostly just used in advertising. Most likely, you are asking what a "complementary angle" is? Two complementary angles will always add up to 90 degrees (pi/4). So, if 30 degrees is the starting angle, 60 degrees would be the complementary angle.
What type of goods are commonly used with other goods?
Complementary Complementary goods are commonly used with other goods
What type of goods commonly used with other goods?
Complementary Complementary goods are commonly used with other goods
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.
What does a complementary angle form?
A complementary angle is formed when two angles add up to 90 degrees. For example, if one angle measures 30 degrees, its complementary angle would measure 60 degrees. This concept is often used in geometry, particularly in right triangles, where the two non-right angles are complementary.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What is complementary therapy used for?
Complementary therapy is and should only be used with regular medical therapy. It is not suppose to be used as a replacement or instead of standard medical care.
What does double complementary mean?
Double complementary refers to two sets of colors that consist of complementary pairs. For example, red and green are complementary, as are blue and orange. In a double complementary color scheme, both sets of complementary colors are used together in a design for visual contrast and harmony.
What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?
The template strand is used to make a complementary copy. This is a type of DNA strand.
