0
What else can I help you with?
Related Questions
The greeting Jai Hind was started by which famous person?
Subhash Chandra Bose
What is the motto of Jai Hind College?
Jai Hind College's motto is 'I Will And I Can'.
When was Jai Hind College created?
Jai Hind College was created in 1948.
What are most famous slogans of India freedom fighters?
Jai Hind! Bharath Maata ki Jay!
How to book the classified ad in a Jai Hind newspaper?
you can book classified ad in Jai Hind newspaper very easy through this adfromhomes.com
Which values are reflected in Jai Hind?
Patriotism
What do you say when you salute your national flag?
jai hind
Who given slogan jai hind?
Chempakaraman Pillai
Who tell the motto jai hind?
subhshchanra bose
Who said jai hind?
subas chandra bose
Who used the word jai Hind at first?
Subhas Chandra Bose used the greeting "Jai Hind" first but archives of our freedom struggle shows that it was the famous patriot Dr. Chembakaraman Pillai, who was the first to utter the mantra "Jai Hind".
Who first used the greeting 'jai hind'?
Rabindranath tegore
Trending Questions
What car does Pele drive?
A name for IT fest having a good theme?
What are the parts of the marketing plan?
What is food products order?
What is the Answer Puzzle 134 in Professor Layton and Pandora's Box?
How many children does bobby jindal have?
Where is the boot release on a fiat 500 pop?
Why was Abraham important to Jesus?
What is auto-obtain ip address?
What is the large amount of solute?
What are the cast of victorious doing now?
What are some tips for playing Latin piano chords effectively?
Typically there is a predictable pattern in the selection of victims in an active shooter incident.?
In the report that Maconochie sent back to Britain about the penal colony in Tasmania What two key points were in the report that Maconochie sent back to Britain about the penal colony in Tasmania?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What is the 1968 Jefferson nickel with both sides heads worth?
Who is the only other person to win Oscars for acting and producing apart from George Clooney?
What is the average price for Ralph Lauren bedding?
Where in grocery store do you find solid coconut oil?
What is performance mode in Guitar Hero?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.