0
Transcribe the following strand of DNA into mRNA. DNA T T A G A T?
Wiki User
∙ 7y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
How is dna made into mRNA?
DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.
Which strand of DNA transcribes into mRNA?
The strand running in the 3'-5' end will be the one that RNA copies, as this is the direction of transcription
If DNA is described as a double helix how should mRNA be described-?
mRNA is like a single strand instead of a double strand. If DNA is like a twisted ladder, then mRNA is like a single half of that ladder, with only half the bases.
Process of synthesizing an RNA strand from a DNA template strand?
The synthesis of mRNA from DNA is called transcription.
Where does mRNA travele to in a cell?
mRNA is usually targetted to ribosomes, which transcribe the sequence into a protein. Some mRNA molecules do not code for proteins but instead interract with DNA in the nucleus.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
How is dna made into mRNA?
DNA is not made into mRNA, it is transcribed by mRNA. The DNA molecule is split into two strands by the enzyme helicase. One strand is the sense strand and the other is the anti-sense strand. Then mRNA nucleotides pair with their complimentary DNA bases on the antisense strand. The enzyme RNA polymerase causes the mRNA nucleotides to bond with one another, forming a strand of mRNA.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
How do you transcribe DNA to complemetary RNA?
DNA dependent RNA polymerase is recruited by transcription factors on the promoter (TATA box) and starts transcribing mRNA from DNA by making a complimentary strand to the bottom strand in a 5' to 3' direction. Afterwards, the mRNA is capped with guanine-methyl, its introns are spliced out, and it's given a poly-A tail.
What would the DNA sequence have been for the following mrna strand cuc-aag-ugc-uuc?
mRNA forms a complementary sequence to the DNA it is transcribed from. Therefore, the DNA strand would be the complement (opposite base pair) from what is present in the mRNA. Also, remember that RNA uses uracil (U) in place of thymine (T). For the mRNA strand CUC-AAG-UGC-UUC, the complementary DNA strand would be GAG-TTC-ACG-AAG.
What is formed when reverse transcriptase is used on a strand of mRNA?
A strand of DNA
How many strand of mRNA are transcribed from the two unzipped strands of DNA?
One mRNA strand is made.
How is DNA copied and made into a mRNA?
There is no such process. DNA cannot come from RNA unless it contains reverse transcriptase. However, there is a process that makes mRNA from a DNA strand. This process is called transcription.
What is formed when reverse transcriptase is used on strand of mrna?
A strand of DNA
What is formed when reverse transcriptase is used on of strand of mrna?
A strand of DNA
What is the mRNA of the DNA strand aatcgtttaaatatattgggcccgggcccggggcgcg?
UUAGCAAAUUUAUAUAACCCGGGCCCGGGCCCCGCGC
What sequence represents a dna strand that would compliment the following mrna strand cua ugc aug cca?
Gau acg uac ggc
