0
What Reads the blueprint and brings and inserts correct amino acid in making a protein sequence?
Wiki User
∙ 14y ago
tRNA (transfer ribose nucleic acid.)
Wiki User
∙ 14y ago
Add your answer:
Earn +20 pts
What is a sequence in DNA that codes for a protein and thus determines a trait?
A gene is a DNA sequence that codes for a protein.
How does the sequence of DNA affect the function of a protein?
The sequence of nucleotides in DNA molecule is equivalent and is closely related to an amino acid sequence in the protein molecule. If for any reason the sequence of DNA nucleotides changes it will be reflected in amino acid sequence in the protein. Moreover, the correct sequence of amino acid in the protein will form the correct three-dimensional structure, or tertiary structure, that will confer the biological activity to protein. If a wrong amino acid is translated from a mutated gene in the DNA could change the spatial structure of the protein and therefore modify or erase its biological function.
What is the correct sequence of the the transfer of information in most organisms?
DNA to RNA to Protein.
What determines the sequence of amino-acids in a protein?
The DNA carries the instructions for protein synthesis. These instructions are copied onto mRNA, which then travels to the ribosome. At the ribosome, the mRNA is translated into the correct sequence of amino acids.
Does DNA code carry instructions the correct sequence of nucleic acids in a protein?
Yes, DNA carries the instructions for the correct sequence of nucleic acids in a protein. These instructions are encoded in the DNA molecule as a specific sequence of nucleotide bases (adenine, thymine, cytosine, and guanine). Through a process called transcription, the DNA sequence is transcribed into a messenger RNA (mRNA) molecule, which is then translated into a specific sequence of amino acids to form a protein.
What is the correct sequence of the transfer of information in most organisms?
Dna to Rna to Proteins
What you would find in a gene?
a blueprint of one (sometimes of a few more) protein. It is a simple sequence of four units - A, T, G, C. So a gene looks like e.g. AGATGACTAGTCAAACCCCGGTCGACGCGCTACAT (lets say 10 times longer). This unique sequence of every gene is then translated to sequence of protein (protein = a chain, a sequence of aminoacids).Also, you find "promoter" and "terminator" sequences in each gene, required by gene-processing machinery (gene processing machinery is my own expression, it is not a terminus).
Which type of RNA is called the blueprint for construction of a protein?
The answer is mRNA.
What organelle can be described as the blueprint to the creation of a protein?
The cell nucleus contains the "blueprints" for the production of protein. The "blueprints" are the DNA contained within the nucleus. DNA is often called the blueprint of life.
Which structure determines the sequence of the building blocks in a protein?
DNA determines the sequence of the amino acids (building blocks) in a protein. The sequence of nitrogen bases in the DNA determines the sequence of amino acids in a protein.
What sequence best represents the relationship between DNA and the traits of an organism?
DNA base sequence amino acid sequence protein shape protein function trait
Where are gene sequence for protein in a prion?
there is no "protein in a prion", because prion is nothing but a protein. The gene sequence of this protein is just normal, with nothing special.
