0
What else can I help you with?
What is the molecular sequence which is the blueprint for a protein?
The molecular sequence that serves as the blueprint for a protein is the sequence of nucleotides in a gene, encoded in DNA. This sequence is transcribed into messenger RNA (mRNA), which carries the genetic information from the nucleus to the ribosomes. There, the mRNA sequence is translated into a specific sequence of amino acids, forming a protein. The order of nucleotides ultimately determines the structure and function of the protein.
What is a term that means blueprint for one protein?
The term that refers to a blueprint for one protein is "gene." A gene is a specific sequence of DNA that contains the instructions for synthesizing a particular protein, dictating its amino acid sequence and ultimately determining its structure and function within the cell.
What is the correct sequence of events in forming a protein?
The correct sequence of events in forming a protein is transcription, where the DNA is transcribed into mRNA, followed by translation, where the mRNA is decoded to build a specific sequence of amino acids, and finally, post-translational modifications that help the protein fold into its correct shape and function properly.
Which type of RNA is called the blueprint for construction of a protein?
Messenger RNA (mRNA) is the type of RNA that carries the genetic information from the DNA in the cell's nucleus to the ribosomes in the cytoplasm, where protein synthesis occurs. It is often referred to as the blueprint for constructing a protein because it carries the instructions for the sequence of amino acids that make up the protein.
How does the sequence of DNA affect the function of a protein?
The sequence of nucleotides in DNA molecule is equivalent and is closely related to an amino acid sequence in the protein molecule. If for any reason the sequence of DNA nucleotides changes it will be reflected in amino acid sequence in the protein. Moreover, the correct sequence of amino acid in the protein will form the correct three-dimensional structure, or tertiary structure, that will confer the biological activity to protein. If a wrong amino acid is translated from a mutated gene in the DNA could change the spatial structure of the protein and therefore modify or erase its biological function.
What is the correct sequence of the the transfer of information in most organisms?
DNA to RNA to Protein.
What is the correct order from genes to protein?
The correct order from genes to protein is: DNA (genes) -> transcription -> mRNA -> translation -> protein. During transcription, the DNA sequence is copied into mRNA, which is then translated into a protein at the ribosome.
What is the significance of the sequence "ATG" in DNA and how does it relate to the process of protein synthesis?
The sequence "ATG" in DNA serves as a start codon, indicating the beginning of protein synthesis. This sequence signals the cell to start translating the genetic information into a protein. It is crucial for initiating the process of protein synthesis and ensuring that the correct protein is produced.
Does DNA code carry instructions the correct sequence of nucleic acids in a protein?
Yes, DNA carries the instructions for the correct sequence of nucleic acids in a protein. These instructions are encoded in the DNA molecule as a specific sequence of nucleotide bases (adenine, thymine, cytosine, and guanine). Through a process called transcription, the DNA sequence is transcribed into a messenger RNA (mRNA) molecule, which is then translated into a specific sequence of amino acids to form a protein.
Does The DNA code carries instructions for the correct sequence of nucleic acids in a protein?
Yes, the DNA code carries instructions for the correct sequence of nucleic acids, which ultimately determines the sequence of amino acids in a protein. This process involves transcription, where DNA is converted into messenger RNA (mRNA), followed by translation, where ribosomes synthesize proteins based on the mRNA sequence. Each set of three nucleotides, called a codon, corresponds to a specific amino acid, guiding the formation of the protein. Thus, the DNA sequence directly influences protein structure and function.
Why is the correct sequence of DNA bases important to the production of proteins?
The sequence of DNA is used, through a process involving the different types of RNA, into amino acids to produce the proteins. The sequence is what determines the amino acids used, and thus an incorrect sequence will build a different protein.
What you would find in a gene?
a blueprint of one (sometimes of a few more) protein. It is a simple sequence of four units - A, T, G, C. So a gene looks like e.g. AGATGACTAGTCAAACCCCGGTCGACGCGCTACAT (lets say 10 times longer). This unique sequence of every gene is then translated to sequence of protein (protein = a chain, a sequence of aminoacids).Also, you find "promoter" and "terminator" sequences in each gene, required by gene-processing machinery (gene processing machinery is my own expression, it is not a terminus).
