answersLogoWhite

0

What are the most famous in the US?

User Avatar

Anonymous

∙ 12y ago
Updated: 12/5/2022

NASA

Liberty Bell

Mt. Rushmore

Golden Gate Bridge

Statue of Liberty

User Avatar

Brenden McClure ∙

Lvl 10
∙ 2y ago
Copy

What else can I help you with?

Related Questions

What is the famous food in the US?

McDonald is the most famous.


What is the most famous restaurant in the US?

i think the most famous resturant is mcdonalds.


What is the most famous place in US?

Washington, D.C. is known throughout the world. In my opinion, it is the most famous place in the US.


Who is the most famous football player of US?

New England Patriots Quarterback Tom Brady is the most famous football player in the US.


What is the most famous river in US?

Mississippi


What is the most famous swamp in the US?

Everglades


What is the most famous statue in the US?

Texas


What is most famous name in the US?

george


What is the most famous tributary that is not in the US?

something


Who is the most famous dancer from the us today?

Misty Copeland, principal dancer with the American Ballet Theater, is arguably the most famous dancer from the US today.


What is the US State of Michigan famous for?

The US state of Michigan is most famous for automobile production. This includes trucks as well.


Who is the most famous person in the US?

Abraham Lincoln

Trending Questions
Should I have my car wrapped? Why does light have a dual wave particle model? What does the carrying of seeds to a new place? What was F. Scott Fitzgerald's daughter's name? What is the lecithin daily intake? What did suyuan woo tell an-mei when an-mei prepared for her trip to china? What cranial nerve is used for pupillary constriction? Can you use August in a sentence please? How many electrons in one columb? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What is the significance of the spiritual rosary in the practice of prayer and meditation? How many votes does each state have in the electorial college? What is the closest airport to Osage Beach MO? How do you remove center console from 2004 Hyundai xg350? Is the Grand National cruel? What are symptoms of chiari malformation? What is the most poinsonous land snake? How do you integrate e powerintegral2x-1? Deciduous trees are those that? What is the US Mining Law of 1812?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.