0
What else can I help you with?
Related Questions
Who was the prime minister at the start of wold war 2?
Mackenzie king
What was the primary function of the office of wold war 2 information?
it wold war was bad
Wold war 2 why was wold war two dangerous?
It was a war so it was obviously dangerous. Think guns and bombs.
Can women fly during war?
wold war 2
Who was president war wold 2?
roosevelt
Leaders In Wold War 2 Information?
thankyou
Was Denmark occupied in wold war 2?
YES
What year wold war 2 finish?
1945
Where was wold war 2 fought?
in Europe and in the Pacific
Where did wold war 2 end?
it ended in england
Who was the leader of italy in the 2 wold war?
Benito Mussolini .
What cause wold war 2?
Germany invaded Poland.
Trending Questions
What is the longest lasting chinese dynasty?
What kind of science does anatomist study?
How much do the city council members get paid?
How did the colonies avoid paying the heavy taxes on British goods?
What is the positive difference between the number of large apples and the number of small apples in the small bushel of apples Megan purchased?
How many belgium 12 gauge auto 5 s were produced?
How many quarts does a 3.0L 2008 Ford Ranger take?
What is the driving distance between akron Ohio and alliance Ohio?
Got a ticket less than a year ago in Ohio and live in California and my insurance went up is it too late go to traffic school?
What are the chances for Japan to surrender in World War before the bombing of Hiroshima and Nagasaki?
What are the underwriting considerations for marine cargo insurance?
Where is the Halo 3 skull 14 location?
What did popcap create?
Are the minerals which appear in metamorphic rocks largely the same as those in igneous rocks?
What are the torque specs for a Geo Metro front wheel bearings?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
What order should you use to list your sources in a bibliography?
What year is your robbins Myers fan list no 5304?
What three sectors must be included when studying the classical period?
How do you know your philhealth number?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.