0
DNA replication is a semi-conservative process. The DNA is split into two strands. Nucleotides are then attached to each strand by complementary base pairing, where A attaches to T and G attaches to C. The newly formed strand is hence identical to the old strand and the base sequence of DNA can hence be conserved during replication.
Wiki User
∙ 9y ago
Add your answer:
Earn +20 pts
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What would happen to a cell or organism if DNA did not got through replication?
It would not be a cell or organism as we understand it. DNA replication is the main event and if DNA had a purpose this would be it.
If DNA aattgccgt what is its complement?
The complementary strand to yours would be ATGCAA. Just remember that T is complementary to A and C is complementary to G.
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What is the corresponding sequence of t-a-c-a-a-c-g-t-g?
It will be based on the process in which it involved- for replication, transcription or translation As a rule the bases will be expressed in Capital letters If it is replication the sequence will A-T-G-T-T-G-G-A-C as the components of DNA is Adenine,Guianine, cytosine and thymine But if it is for transcription it will be A-U-G-U-U-G-G-A-C as in RNA thymine is replace by uracil Sreekala.K.P
How would the amino acid sequence produced by the mutant strand compare to the amino acid sequence produced by series 1?
one amino acid in the sequence would change
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
What would happen to a cell or organism if DNA did not got through replication?
It would not be a cell or organism as we understand it. DNA replication is the main event and if DNA had a purpose this would be it.
During replication which sequence of nucleotides would pair with the DNA segment ttacgc?
You have one too many bases.
What amino acid would be produced if transcription took place from the DNA sequence CAT?
g
What separates the DNA strands during replication?
That would be called the Replication Fork
If DNA aattgccgt what is its complement?
The complementary strand to yours would be ATGCAA. Just remember that T is complementary to A and C is complementary to G.
How would the transcription of eukaryotic gene be affected if a replication error changed the nucleotide sequence of the termination signal for that gene?
Extra long proteins are likely to fold improperly and not function correctly. The overall health of the individual would be destroyed.
Why is complementary base pairing necessary for replication?
Complementary base pairing is necessary because it ensures the fidelity of the DNA sequence during replication. Because only one base can pair with only one other, the two daughter strands of DNA made during replication will be the exact same as the original parent strand. If this were not the case DNA replication would result in random DNA sequences.
Why is DNA replication?
The replication of DNA forms new DNA which form new cells when put in the cells of new nucleus's. The body continuously needs to produce new cells through mitosis for growth and repair and therefore without DNA replication these new cells would not be able to be made, which are needed in the human body.
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
