answersLogoWhite

0

What do Spartans eat?

User Avatar

Anonymous

∙ 14y ago
Updated: 8/16/2019

Spartans were vegetarians that mainly ate Pizza and triple cheeseburgers with bacon, lettuce, tomatoes, pickles, onions, mustard, ketchup, mayo, all on a sesame seed bun.....anyone else hungry?

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions

Who did the Spartans admire?

Spartans? Huh, Nobody.The Spartans Idol Was Themselves...


Why is Spartans called Spartans?

Because they were from Sparta.


Are the Spartans from Rome or Greece?

The Spartans are Greeks.


What did the Spartans do to the helots that defeated them?

If the helots defeated the Spartans, the Spartans, being defeated, could not do anything to them.


What slogan can be given for Spartans?

we will win this for others lives depend on it


What is a sport Spartans play?

The spartans played football


What is the French word for Spartans?

Spartans would be translated as "Spartes".


The difference between Spartans and Athens?

Spartans had a better armty


How old are the Spartans?

the SPARTANS ARE ACTUALLY 12 YEARS OLD


When was Spartans F.C. created?

Spartans F.C. was created in 1978.


When was Spartans W.F.C. created?

Spartans W.F.C. was created in 1985.


What were Spartans committed to?

The Spartans focused on war, fighting and training.

Trending Questions
List three biological activities that require energy? What type of candy starts with a d? What is meaning of tian shi? International rating of habib metropolitan bank? How long does it take to decompose a foam cup? What can a protagonist approach to conflict show about the cultural values behind a work of literature? What is the mRNA strand for ggctatatcctgcgctatacgcta? Where was the best place to build motte and bailey castles? Is Pokemon Rumble for wiiware software or is it on a disk? How fast can the ferrari 612 GTO go? What 2 sides fought in world war 1? What word is formed by unscrambling the letters iamgseo? How do you change the wheel bearings in a Oldsmobile Alero? When did Graham Martin die? Where is shark valley and what species of sharks live there? Does Uranus have snow? What NFL teams did Randell Cunningham play for? What is the significance of the upside down quarter note in music notation? How do I measure correctly to order window treatments? How do you fix a twisted ankle?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.