answersLogoWhite

0


Best Answer

TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT

User Avatar

Wiki User

8y ago
This answer is:
User Avatar
More answers
User Avatar

Wiki User

13y ago

AN individual's Unique sequence of DNA base pairs,determine by exposing a sample of the person's DNA to molecular probes.

This answer is:
User Avatar

User Avatar

Wiki User

13y ago

DNA looks like a double helix.

A good comparison would be a step ladder twisted along its vertical axis, creating a double spiral of connected strands.

This answer is:
User Avatar

User Avatar

Wiki User

13y ago

Twisted ladder and a double helix figure with bonds. Genes do not show but they are included.

This answer is:
User Avatar

User Avatar

Wiki User

13y ago

It looks like a twisted ladder

This answer is:
User Avatar

User Avatar

Wiki User

9y ago

this is dna

This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: What does a DNA nucleotide look like?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Related questions

Definition of DNA nucleotide?

is the change in the nucleotide sequence of DNA


How does the sugar in the DNA in nucleotide differ from that of an RNA Nucleotide?

The sugar in a DNA nucleotide contains one less oxygen atom.


How does the sugar in a DNA nucleotide differ from that on an RNA nucleotide?

The sugar in a DNA nucleotide contains one less oxygen atom.


How does the sugars in a DNA nucleotide differ from that of an RNA nucleotide?

The sugar in a DNA nucleotide contains one less oxygen atom.


How does the sugar in a DNA nucleotide differ from that in a RNA nucleotide?

The sugar in a DNA nucleotide contains one less oxygen atom.


How does the sugar in a DNA nucleotide differ from of an RNA nucleotide?

The sugar in a DNA nucleotide contains one less oxygen atom.


Which nucleotide will bind A nucleotide to parental DNA?

t


What is the name of the monomers of DNA?

a DNA nucleotide


What is the order of size between codon chromosome nucleotide DNA and nucleosome?

this is incorrect question, because the size of the DNA is not specified. Without the DNA, it is chromosome > nucleosome > nucleotide. The actual DNA cannot be longer than a chromosome and nucleotide is a monomer of polymeric DNA, so DNA should be somewhere between chromosome and nucleotide.


What is a Dna letter made of?

The Dna letter is a nucleotide base. It is made from a series of nucleotide base substrates.


What are the nucleotides of DNA and rnaa what are there compliments?

DNA nucleotides: adenine nucleotide, guanine nucleotide, cytosine nucleotide, thymine nucleotideRNA nucleotides: adenine nucleotide, guanine nucleotide, cytosine nucleotide, uracil nucleotideBase-pairing in DNA: adenine and thymine, guanine and cytosineBase-pairing in RNA: adenine and uracil, guanine and cytosine


Are nucleotides pieces that form the dna molecule?

DNA is composed of nucleotides. DNA is essentially a polymer made up of nucleotide monomers