TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
AN individual's Unique sequence of DNA base pairs,determine by exposing a sample of the person's DNA to molecular probes.
DNA looks like a double helix.
A good comparison would be a step ladder twisted along its vertical axis, creating a double spiral of connected strands.
Twisted ladder and a double helix figure with bonds. Genes do not show but they are included.
It looks like a twisted ladder
this is dna
A DNA nucleotide is made up of a sugar(deoxyribose), a phosphate group and a nitrogenous base. The nitrogenous bases in DNA are guanine, cytosine, adenine, and thymine.
A nucleotide is composed of a Nitrogenous base, a phosphate, and a ribose sugar.
this is called a mutation
Gene is a collection of DNA which is made up of nucleotides.
If I understand your question, the answer is DNA synthesis. The nucleus contains DNA. That DNA is in different forms at different times during the cell cycle.
is the change in the nucleotide sequence of DNA
The sugar in a DNA nucleotide contains one less oxygen atom.
The sugar in a DNA nucleotide contains one less oxygen atom.
The sugar in a DNA nucleotide contains one less oxygen atom.
The sugar in a DNA nucleotide contains one less oxygen atom.
The sugar in a DNA nucleotide contains one less oxygen atom.
t
a DNA nucleotide
this is incorrect question, because the size of the DNA is not specified. Without the DNA, it is chromosome > nucleosome > nucleotide. The actual DNA cannot be longer than a chromosome and nucleotide is a monomer of polymeric DNA, so DNA should be somewhere between chromosome and nucleotide.
The Dna letter is a nucleotide base. It is made from a series of nucleotide base substrates.
DNA nucleotides: adenine nucleotide, guanine nucleotide, cytosine nucleotide, thymine nucleotideRNA nucleotides: adenine nucleotide, guanine nucleotide, cytosine nucleotide, uracil nucleotideBase-pairing in DNA: adenine and thymine, guanine and cytosineBase-pairing in RNA: adenine and uracil, guanine and cytosine
DNA is composed of nucleotides. DNA is essentially a polymer made up of nucleotide monomers