0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?
The complimentary mRNA sequence would be: U-A-A-C-G-U
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
GGCAGTTCATGC What would be the sequence of bases on the complimentary stand?
Ccg tca agt acg
What is the complimentary DNA sequence for ttcacgag?
AAGTGCTC
What is the complimentary sequence of ATCGGCTT?
The complimentary sequence of ATCGGCTT will be TAGCCGAA. Because A pairs with T (2 hydrogen bonds), C pairs with G (3 hydrogen bond).
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
What is the correct sequece for t c a g g a c c g?
The correct complimentary DNA sequence would be AGTCCTGGC. The correct complimentary mRNA sequence would be AGUCCUGGC.
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?
The complimentary mRNA sequence would be: U-A-A-C-G-U
Which is the complimentary dna sequence to 5' atgcatgtca 3'?
5' TGACATGCAT 3' The sequence is complementary and in the correct orientation.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
GGCAGTTCATGC What would be the sequence of bases on the complimentary stand?
Ccg tca agt acg
The base sequence of RNA is what to the DNA from which it is transcribed?
complimentary For example, if the DNA codon is GCA, the complimentary mRNA codon will be CGU, according to the base pairing rule.
