0
What else can I help you with?
Related Questions
Can phytoplankton come in different colors?
I think they can.
Where does phytoplankton come in the food chain?
Phytoplankton are eaten by whales and small fish, so...under small fish, I believe. :)
What are the two types of planktons?
Phytoplankton and zooplankton
Why are microorganisms here?
phytoplankton. phytoplankton.
Does phytoplankton eat phytoplankton?
whales
What is the scientific name of phytoplankton?
The scientific name of phytoplankton is phytoplankton. Phytoplankton refers to a diverse group of photosynthetic microorganisms that drift in aquatic environments.
Is a phytoplankton eat other species phytoplankton?
Phytoplankton eats all other kinds of Plankton!?.
Who eats a phytoplankton?
Zooplankton eat phytoplankton
What will eat phytoplankton?
Copepods will eat phytoplankton.
What is the difference between phytoplankton and zooplankton?
phytoplankton are autotrophs and zooplankton are heterotrophs
How are phytoplankton affected by UV radiation?
Ozone depletion allows the UV rays to come in. These rays kill the planktons.
Is a phytoplankton a carnivore or omnivore or herbivore?
Phytoplankton is a herbivore.
Trending Questions
How do you stop remembering the bad things of the past?
What is 'Have a good afternoon' in French?
What causes sleep apnea?
How do you replace voltage regulator?
What do both plants and animals need to survive?
If the probability of type 1 error is reduced the probability of type 2 error is also reduced?
Why did they use bells on horse harness?
If i put 100 dollars in a prepaid credit card will the card be useless until i put more money in it after i spend all 100 dollars or is that the case for prepaid DEBIT cards?
How do you say I love you my princess in spa nish?
What to do when your ex boyfriend tells you he misses you and still loves you?
Who did the Indian National Army fight in World War 2?
JLS were runners-up in the 2008 X Factor final but who to?
Is hypothalamus responsible for vitiligo?
How do you replace tail light 2006 Pontiac Solstice?
Lyrics to the song burn this disco out by Michael Jackson?
Is it the hose or whole radiator if leaking antifreeze?
A river or steam that flows into a larger stream or other bodies of water?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
How much it will cost for 92.7 Big FM radio station in nellore?
When did Michael Jordan start to play with th Chicago Bulls?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.