0
What else can I help you with?
Related Questions
Avery is your husband in Spanish?
Avery es su esposo.
Can you Translate the following from spanish to English Te enviamos saludos mi esposo alfonso y yo?
My husband, Alfonso, and I send you greetings.
How do you say my cousin and her husband in spanish?
Mi prima y su esposo.
Convey my regards to your family in spanish?
Transmite mis saludos a su familia
What does Los saludos mean?
Los saludos means: the greetings.
What does esposo mean in English?
the husband.
What does un esposo mean in spanish?
Husband
How do you say my future girlfriend in spanish?
y su futuro esposo
What does Saludos cordiales mean?
Greetings, how are you? saludos, como estas?
What are some spanish words start with s?
sarten, sabado, su, suyo/a, saber, suecia, sin, sincero/a, seco/a, sucio/a
What does 'esposo' mean in Spanish?
It means "husband". "Esposa" is "wife".
What does saludos desdo Austria mean in English?
Greetings from Austria!
Trending Questions
How can you use inverse operations to solve an equation without algebra titles?
What does a compressional force cause?
What is the economic importance of zygomycota?
Why do women make succesfull leaders?
What are the S.I unit of electrical power?
Why is it important to synthesize a political speech?
How do you get are tithing back from church?
What is the least common multiple of 5 21 43 and 46?
How much water do you give to a radish?
Will there be a halo4?
What are the advantages of saltless water softeners?
What major problems with the utilitarian reliance on measurements include?
What causes global winds to appear to turn instead of blow straight across the earth's surface?
How long can you store nuts in freezer?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
Was shadrach meshech and abednedo eunuchs?
How can the Olympus 100-400mm lens be effectively used to capture stunning images?
What is standing in the middle of piccadilly?
Calculate the simple interest on a loan with a principal of 6000 an interest rate of 7.39 percent and a term of four years?
Who will play as jessica drew in the live action Spider-Woman movie?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.