DNA polymerase
stupid science stuff
tccttttacttcagttctttacc
The two combinations of base pairings possible in DNA are adenine (A) with thymine (T) and cytosine (C) with guanine (G). These pairings occur due to the specific hydrogen bonding patterns between the bases, where A pairs with T through two hydrogen bonds and C pairs with G through three hydrogen bonds. This complementary base pairing is fundamental to the structure of DNA and its replication.
A goes to U and G goes to C. DNA its A=T G=C.
complimentary to each other
DNA has A-T and C-G while RNA has A-U and C-G
The complementary base pairings in DNA are adenine (A) pairing with thymine (T), and cytosine (C) pairing with guanine (G). These pairings contribute to the structure and function of DNA by ensuring the accurate replication of genetic information during cell division. The specific pairing of these bases allows for the double helix structure of DNA to form, which is essential for storing and transmitting genetic information.
Polymerase
I have a vase. on base it reads 517-38 w.germany
In DNA, the only two combinations of base pairings possible for the rungs of the double helix are adenine (A) pairing with thymine (T) and cytosine (C) pairing with guanine (G). This complementary pairing is crucial for the stability of the DNA structure and for accurate replication during cell division.
No, it is a nucleotide base used to construct DNA and RNA
During DNA replication, adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). This base pairing is facilitated by hydrogen bonds, with A forming two hydrogen bonds with T and C forming three hydrogen bonds with G. These specific pairings ensure accurate copying of the genetic information during the replication process.