0
What else can I help you with?
A special enzyne scans the DNA helix in search of improper nitrogen base pairings how would the enzyne be able to detect incorrect nitrogen base pairings?
stupid science stuff
Can you match the base pairings 5'aggaaaatgaagtcaagaaatgg3' 3'--------------------5'?
tccttttacttcagttctttacc
What is the rule for base pairings?
A goes to U and G goes to C. DNA its A=T G=C.
Only two combinations of base pairings are possible for the rungs list them?
The two combinations of base pairings possible in DNA are adenine (A) with thymine (T) and cytosine (C) with guanine (G). These pairings occur due to the specific hydrogen bonding patterns between the bases, where A pairs with T through two hydrogen bonds and C pairs with G through three hydrogen bonds. This complementary base pairing is fundamental to the structure of DNA and its replication.
The strict arrangement of base-pairings in the double helix results in two strands of nucleotides that are?
complimentary to each other
What are the base pairings for DNA and RNA?
DNA has A-T and C-G while RNA has A-U and C-G
What are the complementary base pairings in DNA and how do they contribute to the structure and function of the molecule?
The complementary base pairings in DNA are adenine (A) pairing with thymine (T), and cytosine (C) pairing with guanine (G). These pairings contribute to the structure and function of DNA by ensuring the accurate replication of genetic information during cell division. The specific pairing of these bases allows for the double helix structure of DNA to form, which is essential for storing and transmitting genetic information.
What enzyme is responsible base pairing?
Polymerase
You have an old Vase that on the bottom it reads Foreign 517 38?
I have a vase. on base it reads 517-38 w.germany
Is a adenine an enzyme?
No, it is a nucleotide base used to construct DNA and RNA
Is A C a legitimate base pair?
Not in DNA. In DNA the only base pairs are A-T and C-G. RNA can form non-canonical base pairings, so you might get some AC in RNA structures.
Data on which to base proof or to establish truth or falsehood?
evidence
