0
The DNA polymerase enzyme produces a new DNA strand during DNA replication
Wiki User
∙ 12y ago
Add your answer:
Earn +20 pts
How does DNA semi-conservative replication help prevent mutations in DNA replication?
Semi conservative replication prevents mutations during DNA replication because it produces 2 copies that each contained 1 of the original strands and 1 entirely new strand.
How many strands are replicated in DNA replication?
Two - the leading strand and the lagging strand.
What enzymes produced a new DNA strand during DNA replication?
DNA Polymerase
How many strands of DNA are used as templates during replication?
5'-3' : One strand
What are leading strands?
Leading strands are one of the two newly synthesized DNA strands during DNA replication. They are synthesized in a continuous manner in the 5' to 3' direction, following the replication fork. The leading strand is synthesized in the same direction as the replication fork is moving, allowing for continuous synthesis.
What is the DNA strand that is synthesized continuously during DNA replication?
leading strand
What is the explanation for the process of replication?
During DNA replication, the DNA molecule separates into two strands, then produces two new complementary strands following the rules of base pairing. Each strand of the double helix of DNA serves as a template, or model, for the new strand.
How does DNA semi-conservative replication help prevent mutations in DNA replication?
Semi conservative replication prevents mutations during DNA replication because it produces 2 copies that each contained 1 of the original strands and 1 entirely new strand.
The continually elongating strand of new DNA at one side of a replication fork during replication is known as the?
Leading!
How many strands are replicated in DNA replication?
Two - the leading strand and the lagging strand.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
During dna replication each double helix produced consists of?
one parent strand and one new strand of DNA.
What enzymes produced a new DNA strand during DNA replication?
DNA Polymerase
There is a y shaped replication fork on each side of each replication bubble what are the sides of the replication fork called?
One is known as the Leading strand, and the other is known as the Lagging strand.
How many strands of DNA are used as templates during replication?
5'-3' : One strand
How does transcription differ from DNA replication Describe at least four differences?
DNA replication produces a complimentary DNA strand. Transcription produces a complimentary mRNA strand. The major enzyme that carries out DNA replication is DNA Polymerase III (in prokaryotes). The major enzyme that carries out transcription is RNA Polymerase. DNA replication results in two copies of the DNA. Transciption does not affect the DNA - it simply re-anneals (re-joins) after the process. In DNA replication the complementary base to A is T. In transcription the complementary base to A is U.
What is the name of the DNA replication process that produces two identical DNA molecules each consisting of one parent strand and one daughter strand?
I'm not an expert on this subject but as I've learned, DNA is split into two replication forks where the complimentary base pairs and other backbones are added on, so ideally it would be 50% of the original strand in each daughter strand.
