0
What else can I help you with?
The continually elongating strand of new dna at one side of a replication fork during dna replication is known as?
The continually elongating strand of new DNA at one side of a replication fork during DNA replication is called the leading strand. It is synthesized continuously in the 5' to 3' direction by DNA polymerase.
What is the DNA strand that is synthesized continuously during DNA replication?
The leading strand is the DNA strand that is synthesized continuously during DNA replication. This is because the polymerase enzyme can add nucleotides in the 5' to 3' direction without interruption as the replication fork opens.
What enzyme elongates DNA?
DNA polymerase is the main enzyme responsible for elongating DNA strands during DNA replication. It catalyzes the addition of nucleotides to the growing strand in a 5' to 3' direction.
What is the strand of DNA that forms during replication 5' GGTTTCTTCAAGAGA '3?
The strand of DNA that forms during replication complementary to the sequence 5' GGTTTCTTCAAGAGA 3' is 3' CCAAGAACTTCTCTC 5'. During DNA replication, the new strand is synthesized in the 5' to 3' direction, pairing adenine with thymine and cytosine with guanine. Therefore, the complementary strand would be built from the corresponding bases of the original strand.
What enzyne produces a new DNA strand during DNA replication?
DNA polymerase is the enzyme responsible for producing a new DNA strand during DNA replication. It catalyzes the addition of nucleotides to the growing DNA chain, using the existing DNA strand as a template.
Semiconservative replication involes a template what is the template?
The template for semiconservative replication is the original DNA strand that serves as a guide for creating a new complementary strand. During DNA replication, each original parental strand acts as a template for the synthesis of a new daughter strand.
WHAT IS THE OLD STRAND OF DNA REPLICATION?
The old strand of DNA replication, often referred to as the "template strand," serves as the guide for synthesizing a new complementary strand during DNA replication. In this semi-conservative process, each new DNA double helix consists of one original (old) strand and one newly synthesized strand. This ensures that genetic information is accurately preserved and passed on during cell division. The replication occurs at specific sites called origins of replication, where various enzymes, including DNA polymerase, facilitate the process.
In what direction does a DNA molecule split during replication?
A DNA molecule splits in the 5' to 3' direction during replication. Each strand acts as a template for the synthesis of a new complementary strand.
How many strands are replicated in DNA replication?
During DNA replication, two strands of the double-stranded DNA molecule are unwound and each strand serves as a template for the synthesis of a new complementary strand, resulting in the formation of two new DNA molecules, each composed of one original strand and one newly synthesized strand.
How does DNA polymerase move along the DNA strand, from 3' to 5' direction, during replication?
DNA polymerase moves along the DNA strand in the 3' to 5' direction during replication by adding new nucleotides to the growing strand in a continuous manner. It reads the template strand in the 3' to 5' direction and synthesizes the new strand in the 5' to 3' direction. This process ensures accurate replication of the DNA molecule.
What are the fragments making up the noncontinuous strand called?
The fragments making up the noncontinuous strand in DNA replication are called Okazaki fragments. These are short DNA fragments that are synthesized discontinuously on the lagging strand during DNA replication.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
