0

What has the author R C Agrawal written?

Anonymous

∙ 11y ago

Updated: 8/21/2019

R. C. Agrawal has written:

'Archaeological remains in western India' -- subject(s): Antiquities

Wiki User

∙ 11y ago

What else can I help you with?

Related Questions

What has the author C R Sanderson written?

C. R. Sanderson has written: 'Contrast'

What has the author R C Fawdry written?

R C. Fawdry has written: 'Statics'

What has the author R C Oldfield written?

R. C. Oldfield has written: 'Language'

What has the author R R C De Crespigny written?

R. R. C. De Crespigny has written: 'China'

What has the author R C Penner written?

R. C. Penner has written: 'Discrete Mathematics'

What has the author C R Acton written?

C. R. Acton has written: 'Dog sense'

What has the author C R Wickins written?

C. R. Wickins has written: 'Land of the Donkey'

What has the author R C Bodibe written?

R. C. Bodibe has written: 'Moprofesara ranko'

What has the author R C Brunton written?

R. C. Brunton has written: 'Fibres & threads'

What has the author R C Edwards written?

R. C. Edwards has written: 'The deep six'

What has the author C R Mullong written?

C. R. Mullong has written: 'Beyond paradise'

What has the author C R Bulla written?

C R. Bulla has written: 'Eagle feather'

Trending Questions

How many biweekly pay periods in 2012? What is the value of a 20 gauge Oxford Arms Co double barrel marked April 15 1915? What film did Gene Kelly sing 'halfway down the stairs' in? What are some Examples of the suffix -cide? How many US states line on the Gulf Coastal Plains? What are the differences between skateboarding and basketball? What is cylinder layout 5.4 1997 ford Triton? What made travel to California easier in the 1900S's? What is the current United States Congress? What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'? Did John D. Rockefeller vote for Abraham Lincoln in 1860? How can you tell if an old 20 dollar bill is fake? What do you mean by a disposable income? How do red blood cells do their job? Who invented Audio Port? What was one goal of the Freedmen and Bureau? What did the maker of the lollipop name the candy after? Who was the girl singer in Glenn Miller's band who sang Kalamazoo? What does the word Nike mean? Where can you find WhatMeWorryFins on HorseIsle 2?

Resources

Top Categories

Product

Company

Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.