0
Transient global amnesia
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
What is the prognosis for TGA patients?
The prognosis for TGA patients is excellent
What is the different between TGA and DMTA?
TGA: ThermoGravimetic Analysis DMTA: Dynamical Mechanical Thermal Analysis
What is the market cap for Transglobe Energy Corp TGA?
As of July 2014, the market cap for Transglobe Energy Corp (TGA) is $504,566,469.56.
Drug regulatory authority in Australia?
TGA
What is the prognosis for the patient?
The prognosis for TGA patients is excellent
What is an aruding?
aruding is a Apenas Rodolfo tga camanjac....
Full form of TGA?
Tarun gelo agartala
How is TGA treated?
After ruling out trauma to the brain from accident, disease, or stroke, most people who have experienced TGA receive very little treatment because the condition is benign
What is the real name of Subcool of TGA Seeds?
Brian Rutherford.
How do you add tga badges in fifa manager 2008?
a now
Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?
tttactgttgatggtagaactcgttgttct
Full form of tga transcription factor?
Referring to the TGA1 article in Plant Cell in 1992 by Schindler et al., TGA is an abbreviation for the DNA motif to which TGA1 binds. The authors show that TGA1 binds preferentially to TGACG motifs. Thus the full name should be TGACG motif binding (TGA) transcription factors. Mark Z.
