Tags Parasitology

Animals & Plants Arts & Entertainment Auto Beauty & Health Books and Literature Business Electronics Engineering & Technology Food & Drink History Hobbies Jobs & Education Law & Government Math People & Society Science Social Studies Sports Travel & Places

0

Subjects>Science>Natural Sciences

What is a parasites friend?

Updated: 12/2/2022

Wiki User

∙ 9y ago

Want this question answered?

Be notified when an answer is posted

Add your answer:

Earn +20 pts

Q: What is a parasites friend?

Write your answer...

Submit

Still have questions?

imp

Continue Learning about Natural Sciences

Explanatory slides packages for different parasites and parasites specimens?

Explanatory slides packages for different parasites and parasites specimens.Explanatory slides packages for different parasites and parasites specimens.

Does a tiger have parasites?

They have no parasites

Why are the flies parasites?

Flies are not parasites.

Can you get parasites from sex?

You can get parasites from sex with an infected person.

Are protists parasites?

not all, but most protists are parasites

Related questions

Explanatory slides packages for different parasites and parasites specimens?

Explanatory slides packages for different parasites and parasites specimens.Explanatory slides packages for different parasites and parasites specimens.

Does a tiger have parasites?

They have no parasites

Are snakes parasites?

No - they are not parasites.

Are parasites endangered?

No, parasites are not endangered.

Are penguins parasites?

No, penguins are not parasites

Is centipedes parasites or carnivores?

parasites

Why are the flies parasites?

Flies are not parasites.

Are misquito's parasites?

Yes, mosquitoes are parasites.

Do parasites vary?

Yes, parasites vary

Are parasites bugs?

Some bugs are parasites

Can turpentine cure parasites?

What are your parasites suffering from?

Do cockatiels have parasites?

Yes, cockatiels can get parasites.

Trending Questions

What is a covalent compound? What is the name of that place were 6month day and 6month night? What does a nerve agent affect in the body? Dose a chemical reaction create molecules and compounds? What are the countries with big geographical area? Who was the first to describe the structure of DNA? What evidence from graph 1 suggests that there were still some live bacteria in the milk on day 5? What city is 35 north and 69 east? Why does a large hole give a bright but blurred image? What omnivore eats a tiger? What is natural classification of organisms? What is a mechanical device for artificial respiration that is used to replace or supplement the patients natural breathing function? Where is the shop that sells chronomancer z in aq? What is a famous United States natural landmark? When have earthquakes happened in Wisconsin? In both plant and animal cells the cell mmbrane? What is a reversible hinge? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? Is quicksand a natural disaster? How is catalyst enzyme activation energy substrate related?

Still have questions?

imp

Previously Viewed

What is a parasites friend?

Resources

Top Categories

Product

Company

Copyright ©2024 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.