0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is the function of the chromatain?
The chromatain have four major functions. They package DNA into a smaller volume to fit in the cell. They strengthen the DNA to allow mitosis, and they prevent damage to DNA. Chromatain control gene expression and DNA replication.
What are four charactoristics of eubacteria?
eubacteria lack a nucleus, lack histones in their DNA, have no membrane bound organelles, and their DNA is in a circular form.
Describe the function of electricity and the agarose gel in electrophoresis?
The electricity pulls the polar DNA strands through the gel, and shorter DNA strands move farther because they are less inhibited by the gel. The gel acts as drag to separate the different length DNA strands, so different DNA creates specific dye bands.
What is the function of primers?
RNA primers are used to initiate the DNA replication at the template strand. DNA molecules require a free 3' OH, to which it could add the nucleotides. This free 3' OH is provided by the RNA primer. So prior to the synthesis of DNA a short fragment of RNA is synthesized that is later excised and filled with DNA molecules.
Which series is arranged in order from largest to smallest in size 1chromosome nucleus cell DNA nucleotide?
cell, nucleus, chromosome, DNA, nucleotide
Dyad axis DNA nucleosome?
The Nucleosome has an approximate two fold axis of symmetry which is called the Dyad Axis. So when you rotate the Nucleosome by 180 degree you would observe the similar view of Nucleosome before the rotation.
What is the difference between monad dyad and tetrad?
**In the context of music, specifically harmony, a monad, dyad, and tetrad refer to different types of chord structures: **Monad**: A monad is the simplest type of chord, consisting of a single note played simultaneously. It essentially represents a single pitch played on its own. *Dyad*: A dyad is a chord consisting of two notes played simultaneously. Dyads are often called intervals when they consist of two different pitches. The most basic dyad is the interval of a perfect octave, where two notes are played with a frequency ratio of 2:1. *Tetrad*: A tetrad, also known as a four-note chord or seventh chord, consists of four different pitches played simultaneously. These chords often add richness and complexity to music compared to simpler chords like monads and dyads. There are various types of tetrads, including major seventh chords, minor seventh chords, dominant seventh chords, and diminished seventh chords, each with its own distinctive sound and harmonic function. In summary, the main difference between a monad, dyad, and tetrad lies in the number of notes they contain, with monads having one note, dyads having two notes (or intervals), and tetrads having four notes.**
Why do people crave symmetry?
Not everyone craves symmetry, symmetry is an artistic style used by many artists. But on the other hand many artists use abstract concepts that have no symmetry at all. Symmetry in your mind, as in obsessive compulsive disorder, can affect how you think and make you do things that create the world in a perfectly clean way for you.
What is secret pseudo protein code?
the message is Watson and crick discovered the structure of DNA and make sure to space between each word believe me! this took awhile!
The study of human races and their characteristics?
Depends on your heart and intention: Anthropology, or Racism including Racial Biology, DNA, pseudo science, etc in order to divide mankind.
What does a DNA nucleotide look like?
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
What are the two pieces of information from other scientists that enabled James Watson and Francis Crick to discover helical structure of DNA?
the two strands of nucleotides twisting around a central axis.
What are two pieces of information from other scientist that enabled James Watson and Francis Crick to discover the double helical structure of DNA?
the two strands of nucleotides twisting around a central axis.
What is major groove in DNA?
The major groove has the N2 & O2 of the base pairs pointing inwards toward the helical axis, while in the minor groove, the N2 & O2 atoms point outwards.
What is the double helix?
A double helix is often referred to as a "twisted ladder." It consists of two spirals bound together.
What do the structures labeled with the letters represent?
the tertiary structure of DNA include A- B- Z form which differ from each other in geometric according to bases sequences of DNA and condition DNA present in Form A :right handed double helix Most RNA present in this form Major conformation of RNA the most favorable conformation at low concentration of water Bases are displaced away from the axis Major groove is narrow while minor groove is wide Over all shape short and wide Form B : Right handed double helix the most common type of DNA Major conformation of DNA the most favorable conformation at high concentration of water Bases are perpendicular to the axis Major groove is wide while minor groove is narrow Over all shape is long and narrow Form z : Left handed double helix Zigzag form Minor conformation of DNA the most favorable conformation at high concentration of salt Bases are perpendicular to the axis Both major and minor groove are narrow Over all shape is elongate and narrow
How is DNA tested and why?
by DNA fingerprinting method , DNA-DNA hybirdization or DNA sequencing. to know the sequence of DNA
