0
Which base sequence in DNA is complementary to the base sequence atgt?
Wiki User
∙ 8y ago
ATAGCC is complementary to the base sequence TATCGG.
Wiki User
∙ 9y ago
Ken'naria Davis
Wiki User
∙ 14y agoa-->t, t-->a, c-->g, and g-->c
therefore, the corresponding sequence is "tatggcgaa"
Wiki User
∙ 8y agoIn DNA, the complimentary bases are as follows:
A-T
C-G
Therefore, the complimentary sequence to your fragment would be TACA
I hope this answers your question!
Wiki User
∙ 9y agoThe DNA sequence that is complementary to the nitrogen base sequence ACCGTAT is TGGCATA.
Wiki User
∙ 13y agoUAGCGAGG
Add your answer:
Earn +20 pts
What sequence of DNA bases bonds with the DNA base sequent ATGT?
TACA
During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?
ji
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
What is the complementary base sequence of cagttagc-oh?
A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.
What would be the mrna base sequence formed during transcription using the DNA sequence below?
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
What sequence of DNA base bonds with DNA base sequence ATGT?
TACA
What sequence of DNA bases with the DNA base sequence atgt?
TACA
What sequence of DNA bases bonds with the DNA base sequence ATGT.?
TACA
What sequence of DNA bases bonds with the DNA base sequence atgt?
TACA
What sequence of DNA bases bonds with the DNA base sequent ATGT?
TACA
What sequence of DNA bases bonds with the DNA bases sequence atgt?
TACA
What is the complementary base sequence of DNA strand?
TGCA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is the sequence of the complementary DNA strand gaattcggca?
Simple you just look at what base it is then what ever base would be complementary to it, is your answer. ATTGTCCAGT is your answer
During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?
ji
What would be the base sequence for the complementary DNA formed from CGT TA?
ACGGTA
What complementary strand to the DNA sequence TAGTCA is?
The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.
