0
During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?
Wiki User
∙ 7y ago
ji
Jerry Lagrant
Add your answer:
Earn +20 pts
If DNA aattgccgt what is its complement?
The complementary strand to yours would be ATGCAA. Just remember that T is complementary to A and C is complementary to G.
What is the complementary strand to the following sequence UTTCTTT?
Assuming RNA (U): TUUGUUU Assuming DNA: TAAGAAA
What base sequence would be produced through DNA replication?
DNA replication is a semi-conservative process. The DNA is split into two strands. Nucleotides are then attached to each strand by complementary base pairing, where A attaches to T and G attaches to C. The newly formed strand is hence identical to the old strand and the base sequence of DNA can hence be conserved during replication.
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
If DNA aattgccgt what is its complement?
The complementary strand to yours would be ATGCAA. Just remember that T is complementary to A and C is complementary to G.
What sequence is complementary to aggtac?
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
What is the complementary strand to the following sequence UTTCTTT?
Assuming RNA (U): TUUGUUU Assuming DNA: TAAGAAA
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What base sequence would be produced through DNA replication?
DNA replication is a semi-conservative process. The DNA is split into two strands. Nucleotides are then attached to each strand by complementary base pairing, where A attaches to T and G attaches to C. The newly formed strand is hence identical to the old strand and the base sequence of DNA can hence be conserved during replication.
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
What be would the complementary strand of DNA for the following sequence of bases?
lol i hate this question........its in meh science book
What sequence is the sequence of the complementary strand of DNA?
its tcaa
Why is complementary base pairing necessary for replication?
Complementary base pairing is necessary because it ensures the fidelity of the DNA sequence during replication. Because only one base can pair with only one other, the two daughter strands of DNA made during replication will be the exact same as the original parent strand. If this were not the case DNA replication would result in random DNA sequences.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
What is the sequence of complementary strand?
TGCA
