0
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Wiki User
∙ 13y ago
Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). I remember this because A paired with T spells AT.
The complementary DNA sequence to TGCCAT is ACGGTA.
Wiki User
∙ 12y ago
Wiki User
∙ 13y agoATTAAGGACCGCTTGAAACCC
Add your answer:
Earn +20 pts
If the DNA strands are matched up what does that mean?
This means the two strands of DNA are complementary.
How many strands of DNA are used to make complementary DNA?
12
If DNA aattgccgt what is its complement?
The complementary strand to yours would be ATGCAA. Just remember that T is complementary to A and C is complementary to G.
How many strands of DNA are used to make complementary strands of DNA?
i believe its 2. correct me if im wrong
What is the complementary DNA strands?
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
. How are complementary strands of DNA held together?
Complementary strands of DNA are held together by hydrogen bonds connecting complementary bases.
If the DNA strands are matched up what does that mean?
This means the two strands of DNA are complementary.
What does it mean to say DNA polymerase reads a template strand to make the complementary strand?
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
How are complementary of DNA held together?
Complementary strands of DNA are held together by hydrogen bonds connecting complementary bases.
Complementary strand of dna AAT?
Answer and Explanation: For the sequence 5′-GATTACA-3′, the complementary DNA strand would be 3′-CTAATGT-5′. Often, DNA strands are written in the 5′ to 3′ direction, so the complementary strand would be 5′-TGTAATC-3′ when written 5′ to 3′. What is complementary to mRNA?
How many strands of DNA are used to make complementary DNA?
12
If DNA aattgccgt what is its complement?
The complementary strand to yours would be ATGCAA. Just remember that T is complementary to A and C is complementary to G.
How are the strands of a dna molecule related to eachother?
They are complementary.
How many strands of DNA are used to make complementary strands of DNA?
i believe its 2. correct me if im wrong
What sequence is the sequence of the complementary strand of DNA?
its tcaa
How do isolate a particular section of DNA in a eukaryotic cell?
Through the process called hybridization. Two DNA fragments know that they have found their complementary sequence when they coalesce to form hybrid strands.
The two complementary strands of DNA are held together by?
these nutts
