0
Time instead (of) something.
Wiki User
∙ 9y ago
Add your answer:
Earn +20 pts
What amino acid was never coded for?
LEU
Which amino acid is most common in all three animals?
Leu
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What is the one-letter amino acid sequence formed from the following mRNA that codes for a pentapeptide that is an endorphin called Leu-enkephalin?
YGGFL
What is the amino acid order for the following mRNA that codes for a pentapeptide that is an endorphin called leucine enkephalin AUG UAC GGU GGA UUU CUA UAA?
start-Tyr-Gly-Gly-Phe-Leu-stop
What is Romania's money called?
Leu, 1 leu = 100 bani (in Romanian language leu = lion)
What is the Romanian money unit?
They use the Romanian leu ( pronounced lew ).
What is the official currency of Moldova?
The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.
What type of money does Moldova use?
Moldavian Leu and Bani (1 leu = 100 bani).
When was Evelyne Leu born?
Evelyne Leu was born in 1976.
When was Moldovan leu created?
Moldovan leu was created in 1993.
When was Romanian leu created?
Romanian leu was created in 1867.
When was Bank Leu created?
Bank Leu was created in 1755.
When did Bank Leu end?
Bank Leu ended in 2007.
How tall is Kenny Leu?
Kenny Leu is 5' 10".
When was Clariden Leu created?
Clariden Leu was created in 1775.
What currency do Romanians use?
This is leu: 1 leu = 100 bani.
