Time instead (of) something.
LEU
gaugcgauccguaaucugaccau
YGGFL
To form the protein sequence Ala (Alanine), His (Histidine), Trp (Tryptophan), Leu (Leucine), and Lys (Lysine), a total of 5 amino acids are involved. Each amino acid is encoded by one codon in the mRNA, so 5 codons would be required to code for this specific sequence of amino acids.
The amino acid that is most common in all three animals (humans, dogs, and birds) is glycine. Glycine is the simplest amino acid with a hydrogen atom as its side chain, making it a versatile component of proteins.
Leu, 1 leu = 100 bani (in Romanian language leu = lion)
They use the Romanian leu ( pronounced lew ).
The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.
Moldavian Leu and Bani (1 leu = 100 bani).
Evelyne Leu was born in 1976.
Clariden Leu was created in 1775.
Moldovan leu was created in 1993.
Romanian leu was created in 1867.
Bank Leu was created in 1755.
Bank Leu ended in 2007.
Kenny Leu is 5' 10".
This is leu: 1 leu = 100 bani.