0
What else can I help you with?
What amino acid was never coded for?
LEU
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What is the one-letter amino acid sequence formed from the following mRNA that codes for a pentapeptide that is an endorphin called Leu-enkephalin?
YGGFL
Which amino acid is most common in all three animals?
The amino acid that is most common in all three animals (humans, dogs, and birds) is glycine. Glycine is the simplest amino acid with a hydrogen atom as its side chain, making it a versatile component of proteins.
What is the amino acid to uua?
what is the true amino acid is that amino acid aau?
What is Romania's money called?
Leu, 1 leu = 100 bani (in Romanian language leu = lion)
What is the Romanian money unit?
They use the Romanian leu ( pronounced lew ).
What is the official currency of Moldova?
The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.The Moldovan Leu, which consists of 100 bani.
What type of money does Moldova use?
Moldavian Leu and Bani (1 leu = 100 bani).
How tall is Kenny Leu?
Kenny Leu is 5' 10".
When was Bank Leu created?
Bank Leu was created in 1755.
When did Bank Leu end?
Bank Leu ended in 2007.
When was Moldovan leu created?
Moldovan leu was created in 1993.
When was Evelyne Leu born?
Evelyne Leu was born in 1976.
When was Clariden Leu created?
Clariden Leu was created in 1775.
When was Romanian leu created?
Romanian leu was created in 1867.
What currency do Romanians use?
This is leu: 1 leu = 100 bani.
