0
What else can I help you with?
Related Questions
What kind of atmosphere does a emu live in?
emu bay
Is earth the only planet with a atmosphere?
No not really all have a atmosphere of some kind, some not fit to live in.
What kind of person live on Saturn?
No, because Saturn has an atmosphere, but it's not the same kind of atmosphere as Earth. Humans can't breathe the atmosphere on Saturn and there's no surface on Saturn. It's made of gas.
What kind of atmosphere does the mercury have?
It has a depressing Atmosphere
What atmosphere do you live in?
we live in the troposphere
What is the layer of the atmosphere where you live in called?
The layer of the atmosphere where we live and breathe is called the troposphere
What kind of atmosphere its outside of the Milky Way?
There is no atmosphere in interstellar space.
What layer of the atmosphere do you live in?
The Troposphere.
Do you live in the thermosphere of the atmosphere?
No. People live in the troposphere.
Where do octupus live?
the atmosphere
What is the atmosphere you live in?
The troposphere
What atmosphere do we live in?
Troposphere
Trending Questions
I got a Winchester model 88 243 ser67733 its got a Monte Carlo stock and a black tip no checkering any info on this one?
Which of the follwing terms are the core beliefs that motivate attitudes and actions?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
What are all the episodes that Team Magma appear in?
Who are Buddy Rich's children?
40 percent as a decimal?
How old is Jim Lee?
What does a grub look like?
Where is the brake light fuse for Dodge Durango?
What are the top selling gumball flavors in the US?
Theodore Roosevelt's domestic policy was called?
How do you contact with Ikeda Akihisa the author of Rosario plus Vampire?
Stock subscription payables is debt?
What are the reproductive parts of an earthworm?
What celebrities are emos?
Did Benjamin Rush have any siblings?
How are items moved out of a wardrobe in subeta?
What actors and actresses appeared in Bocaue Pagoda Tragedy - 1995?
Can Piccolo and Goku fuse?
Who was jf brondel?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.