0
What else can I help you with?
What part of nucleotide contains the genetic code?
strand of DNA
What determines the mRNA sequence?
The genetic code is determined by the specific sequence of four nucleotide bases that make up DNA. The bases are guanine, adenine, thymine, and cytosine.
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
The complementary sequence to ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta is ggatagttagaacaatgctgtgcctcatgtgctccggtataaccattaagaaactattgcaat. It pairs adenine with thymine and cytosine with guanine.
What does complimentary sequence mean?
A complimentary sequence is a sequence of DNA or RNA that is complementary to another sequence. In DNA, adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). In RNA, adenine (A) pairs with uracil (U) and cytosine (C) pairs with guanine (G).
Does mRNA use thymine or adenine in its genetic code?
It will use adenine, but thymine will be replaced by a nitrogen base called "uracil" in mRNA
What is the sequence a-c-t-a-g-c-a-t-a?
Adenine-Cytosine-Thymine-Adenine-Guanine-Cytosine-Adenine-Thymine-Adenine
What is the DNA code for A-T-C-G-A?
C-G-A-T-T-A-G-G-C
What part of nucleotide contains the genetic code?
strand of DNA
What determines the mRNA sequence?
The genetic code is determined by the specific sequence of four nucleotide bases that make up DNA. The bases are guanine, adenine, thymine, and cytosine.
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
The complementary sequence to ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta is ggatagttagaacaatgctgtgcctcatgtgctccggtataaccattaagaaactattgcaat. It pairs adenine with thymine and cytosine with guanine.
What does complimentary sequence mean?
A complimentary sequence is a sequence of DNA or RNA that is complementary to another sequence. In DNA, adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). In RNA, adenine (A) pairs with uracil (U) and cytosine (C) pairs with guanine (G).
What does the presence of the nucleotides adenine (A) and thymine (T) in a DNA sequence signify?
The presence of the nucleotides adenine (A) and thymine (T) in a DNA sequence signifies a complementary base pairing, where A always pairs with T.
Does mRNA use thymine or adenine in its genetic code?
It will use adenine, but thymine will be replaced by a nitrogen base called "uracil" in mRNA
What is this pattern called - TTsrTTsr?
This pattern is called a DNA sequence and represents a segment of genetic code that contains the sequence of nucleotide bases adenine (A), thymine (T), cytosine (C), and guanine (G). Each of these letters corresponds to a different nucleotide base.
If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
If you have 13 percent thymine in DNA what is then how much adenine do you have?
Then you also have 13% cytosine, 37% guanine, and 37% adenine.
DNA controls traits through the sequence of its what?
DNA controls traits through the sequence of its nucleotides. These nucleotides form genes, which are instructions for making proteins that determine traits in an organism. The specific sequence of nucleotides in DNA determines the genetic code that directs the synthesis of proteins.
