0
What else can I help you with?
Related Questions
Which US State is the largest and where does that state rank in population?
Alaska is the largest US State and ranks #47 in population.
What state in the us has the largest and smallest population?
the largest population state is California and the smallest population state is Rhode island
What is us's biggest state?
Alaska is the largest state in the US by area. California is the largest state in the US by population.
What is the biigest state in the US?
Alaska is the largest state by area in the US, California is the largest by population.
Which US state has the largest popul?
California has the largest population.
Which US state is the largest in population?
California.
What is the capital of the US state with the largest population?
The state with the largest population is California, and its capital is Sacramento. (see the related question)
What US state has the 13th largest population?
Washington with a population of 6,724,540.
Which state in the contiguous US is the largest?
Texas is largest in area; California is largest in population.
What state in the larger region is the northern most state?
The largest region in the US is the Southern US. Its northernmost state is Maryland.
Which state has the fourth-largest population in the US?
Florida.
Which us state has largest Tongan population?
California
Trending Questions
What is the longest lasting chinese dynasty?
What kind of science does anatomist study?
How much do the city council members get paid?
How did the colonies avoid paying the heavy taxes on British goods?
What is the positive difference between the number of large apples and the number of small apples in the small bushel of apples Megan purchased?
How many belgium 12 gauge auto 5 s were produced?
How many quarts does a 3.0L 2008 Ford Ranger take?
What is the driving distance between akron Ohio and alliance Ohio?
Got a ticket less than a year ago in Ohio and live in California and my insurance went up is it too late go to traffic school?
What are the chances for Japan to surrender in World War before the bombing of Hiroshima and Nagasaki?
What are the underwriting considerations for marine cargo insurance?
Where is the Halo 3 skull 14 location?
What did popcap create?
Are the minerals which appear in metamorphic rocks largely the same as those in igneous rocks?
What are the torque specs for a Geo Metro front wheel bearings?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
What order should you use to list your sources in a bibliography?
What year is your robbins Myers fan list no 5304?
What three sectors must be included when studying the classical period?
How do you know your philhealth number?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.