0
What else can I help you with?
Related Questions
Who was anne and frank mum and dad called?
Anne Franks mum and dad were called Edith and Otto Frank. Her sister was called Margot and Anne was called Annelies Marie Frank!
What is anne franks mum and dad called?
Anne's mother's name is Edith Hollaender and her father's name is Otto H. Frank
What is Otto Franks nickname?
anne called otto frank pim.
What was ann franks mum called?
Edith Frank-Holländer
Who is Anne Franks's dad?
The name of Anne Franks dad is Otto Frank.
What was Anne Frank dad called?
Anne franks dads name was Otto frank
Where did Anne Franks father work?
anne franks father, otto worked at a company called opteka works it was a company that made fruit nectar called pectin.
Was ann franks dad called otto?
Opekta-Works and Trading Company Gies & Co.
Who were Otto Franks parents?
Otto Frank's Father was called Michael frank
What is Otto Franks middle name?
Heinrich.
What was the name of Otto franks business?
ween
What is Ann Franks farther called?
His name is Otto Frank, however Anne's "pet name", or nickname, for him is Pim.
Trending Questions
Is 0.420 less than 0.42?
Can you record on iMac?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Why the need for redenomination in Ghana?
Is it illegal for a 17 year old girl to run away in California?
Where is the fuel pump relay on a 93' mercury topaz?
How much are 100mw laser pens?
How do you adjust governor screw to make peace sport 2012 scooter faster?
What is 15 percent of 3200?
What is made by combining monomer compounds into polymer molecules?
Which culture did the gunpowder the abacus and the compass?
What can adult stem cell turn into?
What are the chances of pregnancy on day twenty-two?
What is prime factor of 27?
What are Roman numarals?
Does the trombone use a mouth piece?
Is orange an earth tone color?
What has seven lines?
What is the name of the Telugu version written by veeresalingam regarding Gulliver's Travels?
How far can the longstrike shoot?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.