0
What else can I help you with?
Related Questions
They were a major threat to the empire of Charles?
a protsetant rebellion in Spain
Why did Ghana empire collapsed?
overgrazing and invasion and also internal rebellion
What is the name of the rebellion that took place in the Holy Roman Empire?
There were a great many rebellions during the 1044 years of this empire.
The empire state is?
New York is the Empire State
What is the empire state buiding for?
The Empire State Building is an office building.
What state is the empire state of the south?
Georgia is called "The Empire State of the South".
What are the empire state?
New York is known as the "Empire State"
Who was empire state named after?
"Empire State" is a common nickname for New York State.
Where did the Empire State Building get its name from?
The nickname for New York state is the Empire State.
Why did the Shang Dynasty empire fail?
Because They just felt like it!
What is the nickname for the state New York?
The state nickname for New York is The Empire State, and the state's motto is Excelsior. The state has an estimated population of 19.57 million.
How do you spell Empire state building?
Empire State Building
Trending Questions
How many miles between Scottsboro Alabama and Baton Rouge Louisiana?
What is the mRNA strand for ggctatatcctgcgctatacgcta?
What is a thin strand of hair called?
How many extinct animals are there right now in the world?
How do you download Vista drivers for a H P printer?
How many countries were effected by world war 1?
Why is it important to mind your own business?
What does the father begets the son mean?
What does PAP look like?
Why is the chicken drumstick indigestible for old lady?
What fraction correctly represents 0.63?
What are the standard dimensions of a home door?
What is the name of Paul McCartney's sheepdog?
How many years in a sesquicentenary?
What is a icd 9 code for ESR?
How do you build gondola the base mysims kingdom?
Why does buttermilk look kind of like yogurt?
What type of polynomial is shown below 7x2-3x plus 4?
Can you give an example of a response to a welcome speech for church?
How many northern pikes are caught a year in Minnesota?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.