0
Charles Dalton died on June 11, 1942, in Stamford, Connecticut, USA.
What else can I help you with?
Related Questions
When was Charles Dalton born?
Charles Dalton was born on August 29, 1864, in Rochester, Kent, England, UK.
When did Cal Dalton die?
Cal Dalton died in 1974.
When did Karen Dalton die?
Karen Dalton died in 1993.
When did Millican Dalton die?
Millican Dalton died in 1947.
When did Roque Dalton die?
Roque Dalton died in 1975.
When did Gene Dalton die?
Gene Dalton died in 1997.
When did Dalton Conyngham die?
Dalton Conyngham died in 1979.
When did Lawrence Dalton die?
Lawrence Dalton died in 1561.
When did Philip Dalton die?
Philip Dalton died in 1941.
When did Jeremy Dalton die?
Jeremy Dalton died in 2005.
When did Ruth Dalton die?
Ruth Dalton died in 1966.
When did Barney Dalton die?
Barney Dalton died in 1929.
Trending Questions
How would you define constrictive pericarditis?
Were the medes allies of the Assyrians?
Can you install a flash player on your Wii?
What is 8Cr13MoV stainless steel blades?
What is the basic SI unit of volume called?
What definition of abnormal behavior is Bill using?
What creek or stream is between Creek Rd and S Water in buffalo NY?
Do girls like men in thong underwear?
How do you draw a Halo 3 warthog step by step?
Blood leaves through the semilunar valve and goes into the?
Danger danger lies ahead skirt it with a delicate thread do not stick your chin out or you'll regret it no doubt?
How many places in philippines?
What does cells of eurayotes take place in?
What math classes do you have to take to get into Yale?
What is textile?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What was the main reason that American colonists opposed the stamp act?
Who was Edwin Holmes and Thomas Watson?
What drink is made in England?
How do you do a flipnote on computer?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.