0
What else can I help you with?
Related Questions
What land did Lief Erickson discover?
Newfoundland (Canada)GreenlandIceland
What did lief erickson explore?
The east coast of Canada.
On which date did lief erickson discover America?
In the year 1002 or 1003.
What is the name of the place Lief Erickson found in Canada?
Vinland.
Where was lief erickson born?
Lief Erickson was born in Iceland.
Why did Lief Erickson discover Newfoundland?
Because it was there. He was just sailing along through uncharted waters and there it was.
What year did Lief Erickson discover North America?
Lief Erikson is believed to have discovered North America around the year 1000 AD. He landed on the coast of North America, in what is now considered Newfoundland, Canada.
Was Lief Erickson in Canada?
yes because there were dogs with seven ears a holy god named gogalore
Where was lief Erikson born?
lief Erickson was born in iceland
In what year did lief ericson discover Canada?
In the year 1002 or 1003.
Who first saw North America?
It is strongly believed that Christopher Columbus was the one who discovered North America. He is the father of the New World.
What did lief Erickson find?
Leif Erickson found nova Scotia.
Trending Questions
Roosevelts New Nationalism program primarily hoped to?
Two numbers have a sum of 31 and a product of 228 What are the numbers?
What Native American group that lived in the American southwest also known for cliff dwellings?
Who were the green police of Holocaust?
What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?
What does it means when a boy says there were taking a cold shower?
How do you get the clear bell in Pokemon liquid crystal?
Who got ball first in the Super Bowl this year?
What is the trigonometric values 82 degrees and 12 minutes using 3 major functions?
What should one do during a lion attack?
What is 42 over 441 in simplest form?
What percent of people in their late teens and early twenties have credit cards?
What does an egg represent when given as a gift?
What is a plutino?
When was Dónal Clifford born?
How did the northerners and Southerns view the secession of the south States?
What is Freeze Screen Saver exe Is it good or bad. Should I remove it from PC?
What happens when a relay is operated beyond its rated voltage or current?
What does tu es amusant mean?
What is the motto of Tintern Schools?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.