0
Brown Mark was born in 1962, in Minneapolis, Minnesota, USA.
What else can I help you with?
Related Questions
When was Mark A. Brown born?
Mark A. Brown was born on 1961-02-10.
When was Mark E. Brown born?
Mark E. Brown was born in 1962.
When was Mark Brown - cricketer - born?
Mark Brown - cricketer - was born in 1958.
When was Mark Brown - golfer - born?
Mark Brown - golfer - was born on 1975-02-09.
When was Mark N. Brown born?
Mark N. Brown was born on 1951-11-18.
When was Mark Brown - baseball - born?
Mark Brown - baseball - was born on 1959-07-13.
How old is mark brown?
My name is Mark Brown I was born 12/10/1959
When and where was baseball player Mark Brown born?
Mark Brown was born July 13, 1959, in Bellows Falls, VT, USA.
What is the birth name of Brown Mark?
Brown Mark's birth name is Mark Brown.
When was Alton Brown born?
Mark Alton Brown was born in 1955, in Cincinnati, Ohio, USA.
What has the author Mark Douglas Brown written?
Mark Douglas Brown has written: 'Capone'
Chris brown's brothers?
Chris Brown does not have a brother.
Trending Questions
What is an example of paradoxes?
What part of an element determines its ability to combine with other elements?
How do you Manage copper levels in a hot tub?
Why is a younger person less susceptible to the effect of alcohol as compared to an elderly person?
What kinds of credit cards allow one to apply online?
What should I do if my dog is tired and has a dry nose?
2 cups is equal to how many ml's?
50 ml of hcl is titrated with a solution of 0.24 m naoh it requires 35 ml of naoh to reach the equivalence point what is the concentration of the hcl solution?
Who was Athena' rival in the city-state?
What is a recipe from colonial Rhode Island?
Is there a 1.5 ddis suzuki jimny in a right hand drive version available in the UK?
What is P0153 codes on Toyota Sienna 3.0 engine?
Which concept did the Maya understand before europeans?
What is 12times 8?
Does Jon Gruden still get paid from the buccaneers?
How can I find a replacement head for my Kobalt weed eater?
Why is my kitten growling while playing?
How do you define global environmental scan.?
What is the complementary sequence for atgcccgggtgtcgtagttga?
What happened to st therese of lisieux when she was 4?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.