0
What else can I help you with?
Related Questions
Who invented the first loudspeaker?
horace short
Who invented the loudspeaker first?
Rice Kellogg
Where was the first loudspeaker invented?
In 1958, the first box-enclosed loudspeakers were invented
Who invented the first ever speaker?
First the headphone was developed. Than a headphone capsule was put upsode down on a saucer with a little distance. That was the first loudspeaker. Scroll down to related links and look at "History of loudspeakers".
Does lgks360 have loudspeaker?
lg ks360 does have a loudspeaker !
How do you disrupt or jam a loudspeaker?
up your neighbour's loudspeaker?
Is loudspeaker an input device?
No, Loudspeaker is an output device.
What is the duration of The Loudspeaker?
The duration of The Loudspeaker is 1.12 hours.
How many syllables in loudspeaker?
There are two syllables in "loudspeaker."
When was The Loudspeaker created?
The Loudspeaker was created on 1934-06-01.
Who is the inventor of the loudspeaker?
Name: Johann Phillip Reis-1st loudspeaker Name: Alexander Graham Bell - Electric loudspeaker
Which are the different types of loudspeakers?
1) Crystal Loudspeaker 2) Electrostatic (Condenser/Capacitor) Loudspeaker 3) Dynamic Loudspeaker
Trending Questions
Should juveniles being tried as adults?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
The point where two air masses meet is called a?
How do you get seaman's book what are the requirements?
How did science and technology lead to the growth of Mayan influence?
What is 10 million divide by 9.856?
From where is Vanessa Hudgens mother?
How can you find garibaldi fish?
What is the time to turn a distance of 1 degree?
When was theora stephens born?
Which continent are the himalaya mountains located?
Where do you often find an adjective?
Did Hernando De Soto ever go to school?
Is Hansel and Gretel American literature?
Did Kristinia Debarge go to South Pasadena High School or was she homeschooled?
Is 3 days enough to have a opiate free urine sample?
What do the doctors say about marijuana in your system?
Is regardless a verb?
ranslate this phrase into an algebraic expression.23 more than twice Mai's savingsUse the variable m to represent Mai's savings. how do i do this?
What was The French courtly love song of the Middle Ages called?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.