0
What else can I help you with?
Related Questions
Will fiat 500 wheels fit a grand punto?
yes
How many valves does the 2014 FIAT 500 have?
The 2014 FIAT 500 has 16 valves.
How many valves does the 2012 FIAT 500 have?
The 2012 FIAT 500 has 16 valves.
How many valves does the 2013 FIAT 500 have?
The 2013 FIAT 500 has 16 valves.
Are the fiat panda and fiat 500 similar?
Nope not at all Actually, the chassis on the current European Fiat 500 was derived from the 2003 Fiat Panda. It was upgraded and refined in 2007 for use in the 500. The US Fiat 500 has a significantly reinforced chassis to meet US crash standards. Below are some links to the Fiat 500 USA blog that go into detail on this:
Is the 2013 FIAT 500 electric or gas?
The 2013 FIAT 500 is a gas-powered vehicle.
Is the 2012 FIAT 500 electric or gas?
The 2012 FIAT 500 is a gas-powered vehicle.
What kind of transmission does the 2013 FIAT 500 have?
The 2013 FIAT 500 has a 5-speed manual.
What size engine does the 2013 FIAT 500 have?
The 2013 FIAT 500 has an inline 4 engine.
Is the 2014 FIAT 500 electric or gas?
The 2014 FIAT 500 is a gas-powered vehicle.
What size engine does the 2014 FIAT 500 have?
The 2014 FIAT 500 has an inline 4 engine.
What kind of transmission does the 2012 FIAT 500 have?
The 2012 FIAT 500 has a 5-speed manual.
Trending Questions
I got a Winchester model 88 243 ser67733 its got a Monte Carlo stock and a black tip no checkering any info on this one?
Which of the follwing terms are the core beliefs that motivate attitudes and actions?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
What are all the episodes that Team Magma appear in?
Who are Buddy Rich's children?
40 percent as a decimal?
How old is Jim Lee?
What does a grub look like?
Where is the brake light fuse for Dodge Durango?
What are the top selling gumball flavors in the US?
Theodore Roosevelt's domestic policy was called?
How do you contact with Ikeda Akihisa the author of Rosario plus Vampire?
Stock subscription payables is debt?
What are the reproductive parts of an earthworm?
What celebrities are emos?
Did Benjamin Rush have any siblings?
How are items moved out of a wardrobe in subeta?
What actors and actresses appeared in Bocaue Pagoda Tragedy - 1995?
Can Piccolo and Goku fuse?
Who was jf brondel?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.