0
What else can I help you with?
Related Questions
Where Alexander graham live?
somalia
Does Alexander Graham Bell have any child?
4
How did Alexander Graham Bell live?
with a boom boom in his chest
Did Alexander Graham Bell ever live in America?
Yes.
Where and when was Alexander Graham born?
Alexander Graham Bell
What did Alexander Graham?
Alexander Graham invented the telephone.
What is Alexander Graham Bell's Name?
Alexander graham bell
Who is the founder of telephone?
if you mean the inventor it was Alexander Graham bell
How long did Alexander Graham Bell live?
he was born march 3 1847 he died august 2 1992
Did Alexander Graham Bell live in Minnesota?
No, he lived somewhere in Washington when he became a doctor.
Alexander Graham Bell's wife?
does Alexander graham have a wife
Why did Alexander Graham invent it?
Alexander Graham Bell - invented the Telephone
Trending Questions
Where are all the stamps in Club Penguin?
Who won batting title as a catcher?
What city has this longitude and latitude 41s 175e?
What are the common multiples of 84 and 105?
When is 1159 CST in eastern standard time?
What are the differences in powers between lt governors?
Did Beyonce help Miley Cyrus in her video party in the usa?
What is the past tense of drawdown?
What do you need for a dog to cross the American border?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
How tall is Bobby Wagner?
Modern warfare 2 care package glitch PS3?
How do get cinnamon out of eyes?
What land did Lyndon Johnson acquire?
What day of the week was July 29 1958?
Is organize is a correct word?
How does climate affect leaf structure?
How can I identify a brown fuzzy caterpillar?
What is frequency used for?
How much do sweaters weigh?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.