0
What else can I help you with?
Related Questions
Where do motorhead come from?
Motorhead are from London.
Who sings for motorhead?
Motorhead is fronted by founder/singer/bassist Lemmy Kilminster.
When did Motorhead - video game - happen?
Motorhead - video game - happened in 1998.
When was Motorhead - video game - created?
Motorhead - video game - was created in 1998-04.
When was Motorhead - Motörhead song - created?
Motorhead - Motörhead song - was created in 1977-06.
Who sang Triple H's songs?
The Current Song: The Game is by Motorhead, and Paul LeVesque (Triple H) is a huge Motorhead fan-- and I hear that the guys in Motorhead also are fans of Triple H.
Who is the guitarist for motorhead?
Phil Campbell.
What album will you find the songs motorhead wrote for the WWE?
The following should help you I hope: http://www.allthelyrics.com/lyrics/motorhead/wwe_wreckless_intent_3/
What are the release dates for Behind the Music - 1997 Motorhead?
Behind the Music - 1997 Motorhead was released on: USA: 20 April 2013
Who sings king of king Triple H song?
Its Motorhead, they also made Triple H's other entrance song "The Game"
The Triple H song?
the game by motorhead
Who drew the motorhead logo?
Joe Petagno
Trending Questions
What is the volume of a rectangular prism with a lenght of 10cm a width of 7cm and a height of 5cm?
Who played Seth Bullock on Deadwood?
What is Jenny Craig's phone number?
What do you think the reason is?
What is the percentage of freshwater is groundwater?
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
How does the order of characteristics on a branching tree diagram help demonstrate evolutionary history?
What were the Banana Wars?
If a person files for divorce in North Carolina and cannot serve the other spouse with the divorce papers what would be the status of the divorce?
What is 6 over 39?
Can your boyfriend get in love about licking him?
Who appointed Gerald ford as vice president?
Where do they sell cachetadas candy in Houston?
What are the features and benefits of the keychain viewfinder?
Are you a child of a god or goddess?
Are there any male singers whose musical type is Like Amy winehouse or duffy or joss stone?
What is size of Alberta Canada?
Why were conspirators against Caesar?
Change a starter on 99 Acura TL?
Bakit sinasabing nag-simula ang pabula kay Aesop?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.