0

Where did merchants live?

Anonymous

∙ 9y ago

Updated: 3/29/2022

the medieval merchants would live above or behind their business's.

Dorcas Tremblay ∙

Lvl 13

∙ 3y ago

What else can I help you with?

Related Questions

What type of people do medieval merchants live around?

They live around orther merchants and town people.

Where did the merchants of Ur live?

in Mesopotamia

Where did the merchants of Ur probable live?

in Mesopotamia

Where did the doctors and merchants live on a manor?

"Doctor" in medieval times meant a highly qualified university student, not someone who treated sick people. Doctors did not live in manorial sites. Merchants lived in towns and cities and did not live in manorial sites.

Did merchants and craftspeople live next to the center of sumerian cities?

In my ancient history class we have been learning that merchants set up shop near the ziggurat, so i would guess the mearchants live near there work!!!

How did merchants live back then in when slavery ended in new york?

the lived in the subway to Mexico

What is the plural possessive form of merchants?

Merchants is the plural form of merchant.The possessive form of merchants is merchants'.

How was feudalism different from the manor system?

The manor system protects serfs and merchants like that that live in manors lords protect the serfs and merchants by permitting them to live in the manors in return for their military services. While the feudal system was a way to keep the different classes like Middle Class in order with kings on top and serfs on bottom. They were alike because the serfs and merchants needed to be protected in the manor system and the serfs and merchants were ordered according to the groups by superiority in the feudal system.

What well-defined social classes did the people of Ur live?

rulers and priest, wealthy merchants, artisans

Where do merchants work?

they live by the east coast of the pacific ocean by where china is. <3

What well defined social classes did the people of Ur live?

rulers and priest, wealthy merchants, artisans

Where did most Americans live in the 1790?

Most Americans lived in cities and worked as laborers, craftspeople, and merchants

Trending Questions

Should juveniles being tried as adults? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? The point where two air masses meet is called a? How do you get seaman's book what are the requirements? How did science and technology lead to the growth of Mayan influence? What is 10 million divide by 9.856? From where is Vanessa Hudgens mother? How can you find garibaldi fish? What is the time to turn a distance of 1 degree? When was theora stephens born? Which continent are the himalaya mountains located? Where do you often find an adjective? Did Hernando De Soto ever go to school? Is Hansel and Gretel American literature? Did Kristinia Debarge go to South Pasadena High School or was she homeschooled? Is 3 days enough to have a opiate free urine sample? What do the doctors say about marijuana in your system? Is regardless a verb? ranslate this phrase into an algebraic expression.23 more than twice Mai's savingsUse the variable m to represent Mai's savings. how do i do this? What was The French courtly love song of the Middle Ages called?

Resources

Top Categories

Product

Company

Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.