0
What else can I help you with?
Related Questions
What was Sears Tower used as?
It was an office buildiing created as a corporate office for the Chicago based retailer Sears.
Why was Chicago Sears Tower built?
To consolidate the office functions for Sears.
Why was willis tower is important?
To centralize the office functions of various Sears divisions..\
How is the Sears Tower used?
It is an office building.
What is the uses of the Sears Tower?
office space
Does WikiAnswers have an office in India?
everyone has an office in india.
What is email and fax number for sears complaint dept?
The fax number for sears corporate office is 847.286.8351
Does Sears sell office cubicles?
Sears does sell office cubicles. You can find them for around $300 to $400. There are a few different types that can be purchased like wood and metal.
When did India Office end?
India Office ended in 1947.
When was India Office created?
India Office was created in 1858.
How much office space is there in the sears tower?
theanswer is your mama
What is the largest post office in India?
GPO Mumbai is the largest post office in India.
Trending Questions
What is the difference between a turkey and a chicken?
Why don't you get a shock if you touch the plastic covering of an electric wire?
If the digits of your present age are reversed then you get the age of your son if 1 year ago your age was twice as that of your son find my present age?
Are soods Punjabi?
What is vss on Lincoln continental on 1997?
What are the Yearly Rainfall amounts in Salem Pendleton Eugene Redmond Medford and Lakeview Oregon?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
How can you make a Mazda miata fast?
What best explains why points cannot have a diameter of 0.5 mm?
What continents connected during the ice age?
Is all jack Daniels made in Tennessee?
What is a similarity between a plant root hair cell and an animal small intestine cell?
What is the reaction for Ag plus O2 AgO?
What is the correct method of stopping in in-line skates?
What are some team mascots that begin with the letter T?
Anu anu ang bansang nasakop ng France?
Funnel clouds in a vision or dream?
How to die without hurting yourself?
When did Mount Ruapehu last erupt?
What is specialized agriculture?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.