answersLogoWhite

0

Where was Karl malden born?

User Avatar

Anonymous

∙ 17y ago
Updated: 8/17/2019

Chicago Illinois

User Avatar

Wiki User

∙ 17y ago
Copy

What else can I help you with?

Related Questions

What is Karl Malden's birthday?

Karl Malden was born on March 22, 1912.


When did Karl Malden die?

No. Karl Malden passed away on July 1, 2009.


How tall is Karl Malden?

Karl Malden is 6' 0 1/2".


How old was Karl Malden when he died?

Karl Malden was 97 years old at the time of his death on July 1, 2009. He was born on March 22, 1912.


Is Karl Malden dead?

Yes, Karl Malden died on July 1, 2009.


What is the birth name of Karl Malden?

Karl Malden's birth name is Mladen George Sekulovich.


How old was Karl Malden at death?

Karl Malden died on July 1, 2009 at the age of 97.


Was Karl Malden in the first bourne identity movie?

Karl Malden was not in any of the Bourne Movies. I believe Karl Malden was in The Bourne Identity - in the opening scenes, he is sitting at the end of the table when they are discussing the CIA target - he doesn't have a speaking role.


What role did Karl Malden play in the movie Patton?

General Omar Bradley Karl Malden plays General Omar Bradley in the 1970 movie Patton.


What are the release dates for Reflections on the Silver Screen - 1990 Karl Malden?

Reflections on the Silver Screen - 1990 Karl Malden was released on: USA: 16 June 1993


Who was Leo in Billion Dollar Brain?

Karl Malden


What was Karl Malden's real name?

Mladen Sekulovic

Trending Questions
How did Amedeo Modigliani incorporate elements of African sculpture in Head of a Woman? What is the ideal weight of a man? What did white people of both regions agree and disagree about race and slavery? Guidelines for clinical and non-clinical staff? What music is played at the beginning of the Super Bowl? A Shepherd go with legs and horns of a goat? Why do you see number 42 everywhere you go? How long ago did hunter-gatherer groups first settle in mesopotamia? What is Makeblock mBot Ranger? Is Lake Erie freshwater or saltwater? Gibraltar is the capital of what country? What is the spark plug gap for a 1996 Mercury 25 HP 2 stroke motor? What Is the integer value of n such that n 0? What is the correct complementary DNA starnd for gacatcgttgactacggctgatc? What is stores manual? How many games did it take Fernando Torres to score 50 goals for Liverpool? How do you erase your ds action replay? Is diethyl ether polar or nonpolar? How many sp do you need for the straight hair on stardoll? How many bet does sitsiritsit have?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.