0
Normally DNA and RNA are the same length. However RNA has only one half of the two usually duplicate genetic strands of DNA
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
Is DNA a single strand of nucleotides?
No, DNA, from difference with the RNA, is a double strand of nucleotides. DNA, double strand (hence the double helix nickname). RNA, single strand.
When is uracil used in DNA?
No, it is not found in DNA, thought it is found in RNA.
Why is RNA needed to create proteins?
RNA is a single-stranded structure that is copied from an unzipped DNA strand identically, this is called transcription. The RNA strand contains the complementary base pairs for the DNA sequence. The DNA strand has sections that code for specific proteins, so when the RNA strand is created from the DNA, the RNA strand is then able to recreate the sequence that codes for the proteins. The RNA strand leaves the nucleus, via a nuclear pore, and enters the cytoplasm. In the cytoplasm the RNA strand binds to two Ribosomal subunits, and translation is carried out, producing proteins.
What molecule builds the new strand of RNA during transcription?
RNA Polymerase plays the largest role in unzipping the DNA strand and then synthesizing the RNA strand.
What enzyme is responsible for decodingthe DNA strand into an mRNA?
RNA Polymerase is the enzyme responsible for creating a strand of RNA.
Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?
Yes. The strand of RNA is messenger RNA, mRNA.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
Is DNA a single strand of nucleotides?
No, DNA, from difference with the RNA, is a double strand of nucleotides. DNA, double strand (hence the double helix nickname). RNA, single strand.
When is uracil used in DNA?
No, it is not found in DNA, thought it is found in RNA.
Is DNA or RNA triple stranded?
DNA is generally double stranded and RNA is single stranded.
A major difference in RNA as compared to DNA is?
RNA can move and DNA cant. DNA has a double helix strand and RNA is a single strand.
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
What RNA strand is produced from DNA?
messenger RNA (mRNA)
Why is RNA needed to create proteins?
RNA is a single-stranded structure that is copied from an unzipped DNA strand identically, this is called transcription. The RNA strand contains the complementary base pairs for the DNA sequence. The DNA strand has sections that code for specific proteins, so when the RNA strand is created from the DNA, the RNA strand is then able to recreate the sequence that codes for the proteins. The RNA strand leaves the nucleus, via a nuclear pore, and enters the cytoplasm. In the cytoplasm the RNA strand binds to two Ribosomal subunits, and translation is carried out, producing proteins.
What must happen to a DNA molecule before RNA ploymerase can make RNA?
The double strand helix is opened by enzymes called helicase and this allow the RNA polymerase to copy the DNA strand. The double strand helix is opened by enzymes called helicase and this allow the RNA polymerase to copy the DNA strand.
Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
What molecule builds the new strand of RNA during transcription?
RNA Polymerase plays the largest role in unzipping the DNA strand and then synthesizing the RNA strand.
