0
What else can I help you with?
Related Questions
Who authored the preamble to the constiution?
Gouv Morris.
What is the first paragraph on the constitution called?
The preamble to the constitution.
Where is the purpose of the U.S. Constitution found?
The purpose of the US Consitution is found in the Preamble...!!!
Why do you believe that the preamble of the Texas Constitution is considerably smaller than the preamble of the US Constitution?
It is a state document and not federal. As it is the constitution's preamble is only a paragraph.
Which is the main purpose of the Preamble of the U.S Constitution?
Which is the main purpose of the Preamble of the U.S. Constitution
What was written in the preamble to the constitution?
1787
What would the us citizens do without the Preamble to the constitution?
The Preamble is not an enforceable part of the Constitution.
Which portion of the constitution explains the reasons for writing the document?
Preamble
What does the preamble describes?
the purposes of the constitution
The introductory section of the us constitution?
the preamble
What part of the Constitution starts with the we the people?
Preamble
What is the introduction to the U.S. Constitution.?
That is called the preamble.
Trending Questions
How do you flush hydrocodone from system in 24hrs?
Does a mercy rule exist in youth hockey?
Do you have to pay to get credit card?
What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?
Who is the male coffee mate commercial model?
What type of minerals are found in Yellowstone?
What is GIT infection?
What famous building is in makkah?
How did director morrow leave ncis?
Is a clearing account a liability or an asset?
What is the ards code for catching every Pokemon?
What Types of limericks?
Can you play ourworld on the Android tablet?
What is the sale price on 50 item that is on sale for 25 off?
Where do Greeks find bay leaf?
What does Saturn's symbol look like?
Do Mennonites have sacraments?
How much should a 10 year old 5 foot tall boy weigh?
What is the first thing Wilbur says in Charlotte's Web?
What props were the ancient Greek theatre known for?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.