0
Did anyone concur in the Persian Empire? Ask a sensible question.
If you meant to ask "Who conquered the Persian Empire?", the answer is Alexander the great of Macedon.
What else can I help you with?
Related Questions
What did Francisco Pizarro concur?
He concured the incan empire
What was the name of the Persian Empire?
The Persian Empire.
Who was the Persian empire?
The Persian Empire was not a person.
What empire is east of Sparta and Athens?
Persian Empire
How did Persian Empire and Babylonia Empire interact?
The Persian Empire absorbed the Babylonian Empire.
What strong army did Alexander defeat?
Alexander the Great defeated the Persian empire
How did the Persian Empire and the Babylonians interact?
The Persian Empire absorbed the Baabylonian Empire.
Alexander the Great conquered what empire?
Alexander conquered the Persian Empire.
Is Persian empire and Persian war the same thing?
An empire is an empire, a war is a war.
Did the Persian empire cross the Indus empire?
The Persian Empire incorporated the Indus Valley.
The Persian Empire was brought to an end by?
The Persian Empire was brought to an end by who?
What did Xerxes have to do with the Persian Empire?
Xerxes the Great was king of the Persian Empire.
Trending Questions
How do you spell tightening?
How does Medea help Jason accomplish his task?
What amenities does the business center at this hotel offer for guests?
Can you post toy cap guns on craigslist?
When was candle discovered?
Define debit note?
What is the slope of the line that passes through the points 2 16 and 5 4?
Letter to withdraw from business partnership?
How do you fit a door barrel to a Skoda octavia?
Does Fred live in Columbus Nebraska?
Is there a relay or fuse for a 94 es300 shift solenoid you are getting a shift solenoid E code reading and your overdrive is not working properly?
According to the encoding specificity principle the context in which people encode and later?
Why is that the elements in the fourth group in the periodic table have high boiling point?
4 square roots of 6 divided by four square roots of 8?
Can you file a lis pendis if your mortgage company is refusing to help you keep your home?
How many NBA players are under six feet tall?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What is the fraction for 17.50?
Which of the following best describes Russia's motivation for freeing its serfs?
What are two postmodern literary techniques?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.