0
What else can I help you with?
Related Questions
Do you have to download LEGO universe?
You will have to download Lego universe if you have access to it.
What is the theme for LEGO Universe?
Lego Universe does not have a theme song.
When did Lego Universe happen?
Lego Universe happened in 2010.
How many levels are in LEGO Universe?
There are about 40 levels in Lego Universe.
What is the newest enemy in LEGO Universe?
The newest enemy on Lego Universe are skeletons.
Can you play LEGO universe on an iPad?
No lego universe is only for pc and mac
What is the website for LEGO universe ninjago game?
Lego Universe Ninjago deutsch
Is there a demo of LEGO universe?
You can find demos of Lego universe currently at youtube.com
Do you need to buy LEGO Universe?
no. see "Can you test Lego Universe free?"
When was Lego Universe created?
Lego Universe was created on 2010-10-26.
When was The Universe Maker created?
The Universe Maker was created in 1953.
What malls have LEGO Universe?
Lego land
Trending Questions
When was Northern Nevada Correctional Center created?
Is wood laminate flooring cheap?
What are the names of the main characters in the thief?
Where might one look to find a United Airlines flight status?
What is Bruno Mars favorite season?
How do you clean pet urine from suede sofa?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
What does RAFT stand for in language arts?
What is Heller's test?
What are the list of Aerial Animals?
What are the gifts for run santa run in doodle god?
Where does a ship park?
Which system has parties that are made of coalitions?
What is the meaning of intermediate?
What does non recyclable mean?
Why the Framers did not anticipate the feature of the electoral college system?
Why did Hollis run away from the regans family in pictures of hollis woods?
What innate behavior does a white tiger have?
Which clan did the Yamato clan originate?
What to do to a chicken when it has been attacked by a dog and still alive?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.