answersLogoWhite

0

The primary force that prevents a main sequence star from collapsing under its own gravity is the pressure generated by nuclear fusion in its core. As hydrogen atoms fuse into helium, this fusion process releases an immense amount of energy, creating an outward pressure that counteracts the inward pull of gravity. This balance between gravitational force and the energy produced by fusion is known as hydrostatic equilibrium, allowing the star to maintain its stability throughout the main sequence phase of its lifecycle.

User Avatar

AnswerBot

5mo ago

What else can I help you with?

Continue Learning about Astronomy

How would you arrange this in order red giant white dwarf and main sequence?

The correct order of these stellar evolutionary stages is main sequence, red giant, white dwarf. A star begins its life on the main sequence where it fuses hydrogen into helium. As it runs out of fuel, it expands into a red giant before shedding its outer layers and collapsing into a white dwarf.


What would happen to a nebula if the pressure inside it was greater than the force of gravity?

Well, isn't that a happy little thought! If the pressure inside a nebula were greater than the force of gravity, it might cause the nebula to expand and disperse into the surrounding space. Just like a gentle breeze carrying flower petals through the air, the nebula's beautiful gases could drift away and create new wonders in the cosmos. Remember, in the vast universe, there's always room for new beginnings and endless possibilities.


Why is there an upper mass limit for main-sequence stars of about 100 solar masses?

The upper mass limit for main-sequence stars is around 100 solar masses because the intense radiation and stellar winds in massive stars lead to mass loss through stellar winds and prevent the star from accreting enough material to exceed this limit. Additionally, stars with masses above 100 solar masses would generate such strong radiation pressure that it would overcome the force of gravity, preventing the formation of stable stars with higher masses.


Where would a main sequence star that is cooler and dimmer than the sun appear on the graph?

On a Hertzsprung-Russell diagram, a main sequence star that is cooler and dimmer than the Sun would appear to the right and below the Sun's position. The Sun is located approximately in the middle of the main sequence, so a cooler and dimmer star would have a lower temperature and luminosity compared to the Sun, indicating it would be plotted in the lower left section of the main sequence.


Why doesn't the sun fall out of the sky?

First, if anything were falling, it would be the Earth; the Earth is much, much smaller than the Sun. Secondly, the Earth is constantly falling towards the Sun, but it's also moving sideways at the same time fast enough that it keeps missing.

Related Questions

What will be the reaction force necessary to hold your father up and keep his chair from collapsing on Jupiter?

The reaction force needed to hold your father up and keep his chair from collapsing on Jupiter would be significantly higher than on Earth due to Jupiter's stronger gravitational pull. This force would depend on your father's weight and the strength and stability of the chair, but it would be many times greater than what would be required on Earth.


How would you arrange this in order red giant white dwarf and main sequence?

The correct order of these stellar evolutionary stages is main sequence, red giant, white dwarf. A star begins its life on the main sequence where it fuses hydrogen into helium. As it runs out of fuel, it expands into a red giant before shedding its outer layers and collapsing into a white dwarf.


Is there a video of Michael Jackson collapsing?

No! Why would you even wanna see that?


What is a nth term in a sequence?

Well, it would depend what the sequence was...? If the sequence was 2,4,6,8,10,12,14,16,18,20, then the 9th term would be 18!


What is the main sequence if a black hole?

In astronomy the term main sequence is understood to apply to stellar evolution; since black holes are not themselves considered stars so much as "stellar remnants" they would not fall on this sequence. It would be appropriate to say they are most commonly created at the end of life (once the fuel is exhausted) of a larger star and thus would be more likely to pertain to the most massive stars of the upper main sequence.


What would happen if you tried to squeeze gas into a smaller container?

If you try to squeeze gas into a smaller container, the pressure and temperature of the gas would increase. If the pressure continues to rise, the gas may eventually reach a point where it transitions into a liquid state.


What sequence of mRNA would go with the DNA sequence of act?

If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA


List the two nucleotide sequence that are complementary to the sticky end sequence on the human DNA?

The complementary nucleotide sequence to a sticky end sequence on human DNA would be its reverse complement sequence. For example, if the sticky end sequence is "AATT", its complementary sequence would be "TTAA".


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


Would the word Caldera be capitalized?

If you are talking about the caldera formed by a volcano collapsing then no it shouldn't be capitalized.


How can DNA Sequencing affect your overall health?

DNA sequencing can identify genes that have the potential to cause you health problems. Knowing your DNA sequence could help your overall health in that you would know where potential problems may be. For example, if your sequence shows a potential for diabetes, living a life style that would help prevent diabetes would be helpful.


What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?

The sequence would be GACGGT