answersLogoWhite

0

yes, a single gene can code for multiple proteins by the process of alternative splicing. DNA is transcribed into m-RNA and that is then translated into proteins. The pre m-RNA can be coded for at different sites, it can contain introns that create a different code, or it can have exons spliced from it.

User Avatar

Wiki User

∙ 17y ago

What else can I help you with?

Continue Learning about Biology

A section of DNA that codes for one protein?

A piece of DNA that codes for a particular protein is called a gene.


What does the one gene-one polypeptide state?

The one gene-one polypeptide hypothesis states that each gene is responsible for producing one specific polypeptide, which is a chain of amino acids that forms a protein. However, this hypothesis has been modified to the one gene-one protein hypothesis because some genes code for non-protein products like RNA molecules.


What does the genetic code in a gene code for?

Genes are the code for forming proteins. DNA is formed by nucleotides (adenine, thymine, guanine and cytosine). Every 3 of these bases (along the whole DNA strand), codify for a aminoacid, and several aminoacids form proteins. Several proteins determine a feature. In human genetics, everything except blood type (A, B, AB or 0) is determined by more than one gene.a gene codes for a polypeptide. however recent research shows that a gene doesn't always code for a protein and a gene can result in more than one polypeptide. but for the most part a gene codes for a polypeptide.


The one gene one polypeptide theory states that?

The one gene-one polypeptide theory states that for every gene one protein is synthesized n a cell. This theory has lost favor with the discoveries of post-translational modification, protein splicing and epigenetics, all of which support the production of multiple protein products from a single gene.


Why has beadle and tatoms one gene - one enzyme hypothesis been midified since the presented it in 1940s?

Tatum and Beadle proposed the "one gene one enzyme" theory. One gene code is responsible for the production of a single protein. "One gene one enzyme" is modified to "one gene one polypeptide" because the majority of proteins are composed of multiple polypeptides.

Related Questions

Name for a sequence of DNA bases that code for one protein?

Name for a sequence of DNA bases that code for one protein?


A section of DNA that codes for one protein?

A piece of DNA that codes for a particular protein is called a gene.


What does the one gene-one polypeptide state?

The one gene-one polypeptide hypothesis states that each gene is responsible for producing one specific polypeptide, which is a chain of amino acids that forms a protein. However, this hypothesis has been modified to the one gene-one protein hypothesis because some genes code for non-protein products like RNA molecules.


What does the genetic code in a gene code for?

Genes are the code for forming proteins. DNA is formed by nucleotides (adenine, thymine, guanine and cytosine). Every 3 of these bases (along the whole DNA strand), codify for a aminoacid, and several aminoacids form proteins. Several proteins determine a feature. In human genetics, everything except blood type (A, B, AB or 0) is determined by more than one gene.a gene codes for a polypeptide. however recent research shows that a gene doesn't always code for a protein and a gene can result in more than one polypeptide. but for the most part a gene codes for a polypeptide.


Descibe the difference between the terms allele and genes?

One gene provides the information for on specific protein for one purpose. However, there can be many different variants of this gene due to permutations in the genetic code. This can means more than one type of gene being present in the general population for just one protein, which can change the resulting product (protein). The scientific term for this is allele.


How is the nitrogen base sequence of a gene related to the structure of a protein?

The sequence of nitrogenous bases (A, T, G and C) forms a code for the sequence of amino acids in a protein. The code is a triplet code. This means that three bases code for one amino acid. So, the order of the bases in a gene determines the order of the amino acids in a protein.


The one gene one polypeptide theory states that?

The one gene-one polypeptide theory states that for every gene one protein is synthesized n a cell. This theory has lost favor with the discoveries of post-translational modification, protein splicing and epigenetics, all of which support the production of multiple protein products from a single gene.


What is the job of a gene?

A gene codes for one type of polypeptide (protein).


Why has beadle and tatoms one gene - one enzyme hypothesis been midified since the presented it in 1940s?

Tatum and Beadle proposed the "one gene one enzyme" theory. One gene code is responsible for the production of a single protein. "One gene one enzyme" is modified to "one gene one polypeptide" because the majority of proteins are composed of multiple polypeptides.


Why was the one gene one protein hypothesis altered to one gene one polypeptide hypothesis?

Because one gene codes for one polypeptide and some proteins are made of more than one polypeptide and stuck together after translation of the genes that code for these polypeptides. Not sure if there ever was a one gene one protein hypothesis or if its just something they teach in schools to avoid overcomplicating things.


A gene is a genetic code for what?

A single gene can code for anything, we do not know. For example, if I picked 1 gene and then picked a second one, the first one could code for hair colour, where as the second one could code for freckles. In other words, a gene is a genetic code for a part of yourself.


What you would find in a gene?

a blueprint of one (sometimes of a few more) protein. It is a simple sequence of four units - A, T, G, C. So a gene looks like e.g. AGATGACTAGTCAAACCCCGGTCGACGCGCTACAT (lets say 10 times longer). This unique sequence of every gene is then translated to sequence of protein (protein = a chain, a sequence of aminoacids).Also, you find "promoter" and "terminator" sequences in each gene, required by gene-processing machinery (gene processing machinery is my own expression, it is not a terminus).