answersLogoWhite

0

In mitosis metaphase the mitotic spindel attaches to one side of a pair of chromosomes and seperates them so that one chromosome ends up on each side.

In metaphase 1 of meiosis, the mitotic spindel only attaches to one pair of chromosomes from one side, so that when anaphase occures that pair of chromosomes will end up on one side.

overall

- mitosis metaphase- chromosomes split

- meiosis metaphase 1- chromosome pair stay together and end up one side of the cell.

User Avatar

Wiki User

16y ago

What else can I help you with?

Related Questions

How does metaphase in meiosis differ from metaphase in mitosis?

In metaphase of meiosis, homologous chromosomes line up in pairs, while in metaphase of mitosis, individual chromosomes line up singly.


How long does the lining up of chromosomes during metaphase 1 of meiosis differ from the way they line up during metaphase of mitosis?

3 weeks


How does metaphase 1 differ from metaphase of mitosis?

In metaphase I of meiosis, homologous chromosomes align at the cell's equator in pairs, while in metaphase of mitosis individual chromosomes align. Additionally, in meiosis I, genetic recombination and crossing over can occur between homologous chromosomes, increasing genetic diversity.


Is metaphase a phase in mitosis or meiosis?

Metaphase is a phase in both mitosis and meiosis.


Which stage of mitosis is the last phase that chromatids are together?

metaphase. C:


How many cell division in mitosis in mitosis?

1 splits in two


How is metaphase 1 different in meiosis compared to mitosis?

In metaphase 1 of meiosis, homologous chromosomes line up in pairs at the center of the cell, while in mitosis, individual chromosomes line up singly.


In the metaphase of meiosis 2 and meiosis 1 how do they differ?

metaphase 1 occurs only in mitosis. the metaphase 2 is in meiosis. in metaphase 1, spindle fibers align the homologous chromosomes along the equator so that two chromosomes are on one side, and the other two are on the other side whereas in metaphase 2 spindle fibers align them along the equator so that all four chromosomes get cut in half.


What is the difference between metaphase in mitosis and metaphase I in meiosis?

In metaphase of mitosis, chromosomes line up in the middle of the cell, while in metaphase I of meiosis, homologous chromosomes line up in pairs.


What are the names of the four phases of mitosis?

the four phases of mitosis are prophase, metaphase, anaphase, and telophase


What is the stage between metaphase and anaphase in mitosis?

There is no stage between metaphase and anaphase. Mitosis has four stages, first its prophase then metaphase then anaphase then telophase.


Which phase of mitosis is where the chromosomes are located at the equator of the cell?

The phase of mitosis where the chromosomes are located at the equator of the cell is called the metaphase. Here, the chromosomes align in the middle of the cell, ready to be separated during anaphase.

Trending Questions
Which gland secretes the fight-or-flight hormones? What is the prognosis for a patient with osteomyelitis? At the joints in your body two bones are connected. During movement of these bones Why can younot feel them rubbing against each other Please explain and include an illustration if possible? What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa? Mucosal thickening in the right maxillary sinus? Why is it important that cells have half the number of chromosomes as body cells? What do tibialis anterior and fibularis longus combine to create? A biologist ground up some plant leaf cells and then centrifuged the mixture to fractionate the organelles Organelles in one of the heavier fractions could produce ATP in the light while organelles? Why DNA called the Blueprint of Life? What is the difference between hypertrophy and hyperlasia? What are the benefits to having introns? How many factors did Mendel conclude control each trait? What is the process that creates specialized cells like blood cells nerve cells or bone cells is called? What happens when a cell is full of a new virus? Have you ever experienced any complications or adverse effects from a saline injection that missed the vein? What is cellmembraine? What is the relationship between genes and alleles, and how do they interact in determining an organism's traits? How does the enzyme in curdling milk work to separate the proteins and fats in the milk? How does the phenomenon of phototropism influence the growth of a plant towards light? What is a gene whose effect can be hidden?