0
How many mRNA sequences can code for the simple tripeptide sequence leu-met-tyr?
Wiki User
∙ 15y ago
12:
UUA-AUG-UAU
UUA-AUG-UAC
UUG-AUG-UAU
UUG-AUG-UAC
CUU-AUG-UAU
CUU-AUG-UAC
CUC-AUG-UAU
CUC-AUG-UAC
CUA-AUG-UAU
CUA-AUG-UAC
CUG-AUG-UAU
CUG-AUG-UAC
Wiki User
∙ 15y ago
Add your answer:
Earn +20 pts
What are two features that make plasmids useful for transforming cells?
Simple and short DNA sequence and their inherent separation but later group into the genome sequence.
How do you determine amino acid sequences from Pka values?
The short answer is that you can't. Individual amino acids may be identified by their pI, the point at which they have an overall neutral charge, but finding the pKa of a protein as a whole can't conclusively give you the amino acid sequence of the protein. You may get a sense of whether the protein is acidic or basic overall though. There may be some way to do it if you have other factors involved in your experiment that you haven't divulged (i.e., a limited number of sequences that could be the answer or controls in the experiment), but the simple answer to your question is that it is impossible. Source: Three years of a Biochem degree
How can a mutation in a DNA base sequence cause a change in protein?
dna in a cell needs protein and chromosomes.
What is the sequence of the complementary DNA strand gaattcggca?
Simple you just look at what base it is then what ever base would be complementary to it, is your answer. ATTGTCCAGT is your answer
The sequence of amino acids joined together refers to the?
Peptide sequence or amino acid sequence is the order in which amino acid residues, connected by peptide bonds, lie in the chain in peptides and proteins. The sequence is generally reported from the N-terminal end containing free amino group to the C-terminal end containing free carboxyl group. Peptide sequence is often called protein sequence if it represents the primary structure of a protein.
How do you find the sum of a series of numbers?
There is no simple answer. There are simple formulae for simple sequences such as arithmetic or geometric progressions; there are less simple solutions arising from Taylor or Maclaurin series. But for the majority of sequences there are no solutions.
When was Polymorphic simple sequence repeats database created?
Polymorphic simple sequence repeats database was created in 2010.
How do you find the nth term in a fraction sequence?
work it out it's one more than the 8th and one less than the 10th * * * * * The above answer seems to make no sense here. It is not clear what you mean by a fraction sequence. It is not possible to go through the process for finding the nth term in an arithmetic, geometric or power sequence here. For school mathematics, sequences of fractions are, in fact composed of two simple sequences. One sequence defines the numerators and the other defines the denominators. In such cases, the nth term of the fraction sequence is the fraction given by the nth term of the numerator sequence divided by the nth term of the denominator sequence. For example: 1/1, 3/4, 5/9, 7/16, 9/25, ... The numerators are the odd number, with t(n) = 2n-1 The denominators are the squares of natural numbers with u(n) = n2 So, the nth term of the fraction sequence is (2n-1)/n2.
Is the Fibonacci sequence real?
yes it is simple to
What you would find in a gene?
a blueprint of one (sometimes of a few more) protein. It is a simple sequence of four units - A, T, G, C. So a gene looks like e.g. AGATGACTAGTCAAACCCCGGTCGACGCGCTACAT (lets say 10 times longer). This unique sequence of every gene is then translated to sequence of protein (protein = a chain, a sequence of aminoacids).Also, you find "promoter" and "terminator" sequences in each gene, required by gene-processing machinery (gene processing machinery is my own expression, it is not a terminus).
What are two features that make plasmid useful for transforming?
Simple and short DNA sequence and their inherent separation but later group into the genome sequence.
What is the sequence in which most animals develop?
There is a very simple sequence in which most animals develop. Most animals are born, mature, reproduce, and then die.
What are two features that make plasmids useful for transforming cells?
Simple and short DNA sequence and their inherent separation but later group into the genome sequence.
What number is next in this sequence 3 4 6 9 13?
The nest number in the sequence is 18. Note that the difference between each number and the next number in the sequence follows the simple sequence of 1,2,3,4. Obviously the next in the sequence of increases is 5, so 13+5=18.
Which equation could you use to find the nth term of a simple interest sequence?
345
Why is the fibbonacci sequence special?
There is no fibbonacci sequence. The Fibonacci sequence was devised as a relatively simple growth sequence. It has the property that the ratio of the numbers of the sequence divided by the preceding number in the sequence tends towards phi, the Golden Ratio = [1 + √5]/2 which has important geometric properties.Also, there are very many instances in nature where the Fibonacci sequence may be found.
What is the nth term of the sequence 4 8 12 16?
Given n and any number for the nth term, it is a simple matter to find a rule such that the above four numbers are the first four of a sequence and the given number in the nth position.However, the simple answer for simple questions is Un = 4n
