answersLogoWhite

0

12:

UUA-AUG-UAU

UUA-AUG-UAC

UUG-AUG-UAU

UUG-AUG-UAC

CUU-AUG-UAU

CUU-AUG-UAC

CUC-AUG-UAU

CUC-AUG-UAC

CUA-AUG-UAU

CUA-AUG-UAC

CUG-AUG-UAU

CUG-AUG-UAC

User Avatar

Wiki User

17y ago

What else can I help you with?

Continue Learning about Biology

What is low complexity region in protein sequence when performing blast questions?

These low-complexity sequences occur often and in many (unrelated) types proteins and consist of repetative short fragments. (In example Leusine-rich domains or poly-A tails). These seqs can give rise to false positives in aligment. Blast therefore has a filter (on by default) that excludes these regions in alignments (shown in gray instead of the normal black annotation).


How do you determine amino acid sequences from Pka values?

The short answer is that you can't. Individual amino acids may be identified by their pI, the point at which they have an overall neutral charge, but finding the pKa of a protein as a whole can't conclusively give you the amino acid sequence of the protein. You may get a sense of whether the protein is acidic or basic overall though. There may be some way to do it if you have other factors involved in your experiment that you haven't divulged (i.e., a limited number of sequences that could be the answer or controls in the experiment), but the simple answer to your question is that it is impossible. Source: Three years of a Biochem degree


How can a mutation in a DNA base sequence cause a change in protein?

dna in a cell needs protein and chromosomes.


The sequence of amino acids joined together refers to the?

Peptide sequence or amino acid sequence is the order in which amino acid residues, connected by peptide bonds, lie in the chain in peptides and proteins. The sequence is generally reported from the N-terminal end containing free amino group to the C-terminal end containing free carboxyl group. Peptide sequence is often called protein sequence if it represents the primary structure of a protein.


What is the sequence of the complementary DNA strand gaattcggca?

The complementary DNA strand for "gaattcggca" would be "cttaagccgt." In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). So you would replace each base according to these rules to find the complementary sequence.

Related Questions

How do you find the sum of a series of numbers?

There is no simple answer. There are simple formulae for simple sequences such as arithmetic or geometric progressions; there are less simple solutions arising from Taylor or Maclaurin series. But for the majority of sequences there are no solutions.


When was Polymorphic simple sequence repeats database created?

Polymorphic simple sequence repeats database was created in 2010.


What is low complexity region in protein sequence when performing blast questions?

These low-complexity sequences occur often and in many (unrelated) types proteins and consist of repetative short fragments. (In example Leusine-rich domains or poly-A tails). These seqs can give rise to false positives in aligment. Blast therefore has a filter (on by default) that excludes these regions in alignments (shown in gray instead of the normal black annotation).


Is the Fibonacci sequence real?

yes it is simple to


How do you find the nth term in a fraction sequence?

work it out it's one more than the 8th and one less than the 10th * * * * * The above answer seems to make no sense here. It is not clear what you mean by a fraction sequence. It is not possible to go through the process for finding the nth term in an arithmetic, geometric or power sequence here. For school mathematics, sequences of fractions are, in fact composed of two simple sequences. One sequence defines the numerators and the other defines the denominators. In such cases, the nth term of the fraction sequence is the fraction given by the nth term of the numerator sequence divided by the nth term of the denominator sequence. For example: 1/1, 3/4, 5/9, 7/16, 9/25, ... The numerators are the odd number, with t(n) = 2n-1 The denominators are the squares of natural numbers with u(n) = n2 So, the nth term of the fraction sequence is (2n-1)/n2.


What you would find in a gene?

a blueprint of one (sometimes of a few more) protein. It is a simple sequence of four units - A, T, G, C. So a gene looks like e.g. AGATGACTAGTCAAACCCCGGTCGACGCGCTACAT (lets say 10 times longer). This unique sequence of every gene is then translated to sequence of protein (protein = a chain, a sequence of aminoacids).Also, you find "promoter" and "terminator" sequences in each gene, required by gene-processing machinery (gene processing machinery is my own expression, it is not a terminus).


What is the difference between satellite DNA and repetitive DNA?

Satellite DNA consists of short sequences repeated in tandem, often clustered near the centromere or telomere regions of chromosomes. Repetitive DNA includes all sequences that are repeated multiple times throughout the genome, including satellite DNA as well as other types such as transposable elements and simple sequence repeats.


What is the rule in simple reversal transform?

The rule in a simple reversal transform involves reversing the order of the elements in a data sequence. For example, if you have a list or an array, the first element becomes the last, the second becomes the second-to-last, and so on. This transformation is often used in algorithms and data processing to manipulate sequences efficiently. It can be applied to various data structures, including strings and arrays.


Matlab code for finding linear convolution using circular convolution?

To find linear convolution using circular convolution in MATLAB, you can use the cconv function, which computes the circular convolution of two sequences. To obtain the linear convolution, you need to pad one of the sequences with zeros to the length of the sum of the lengths of both sequences minus one. Here's a simple example: x = [1, 2, 3]; % First input sequence h = [4, 5]; % Second input sequence N = length(x) + length(h) - 1; % Length for linear convolution y = cconv(x, [h, zeros(1, N-length(h))], N); % Circular convolution This will give you the linear convolution result of x and h.


What is the sequence in which most animals develop?

There is a very simple sequence in which most animals develop. Most animals are born, mature, reproduce, and then die.


What are two features that make plasmid useful for transforming?

Simple and short DNA sequence and their inherent separation but later group into the genome sequence.


What number is next in this sequence 3 4 6 9 13?

The nest number in the sequence is 18. Note that the difference between each number and the next number in the sequence follows the simple sequence of 1,2,3,4. Obviously the next in the sequence of increases is 5, so 13+5=18.