0
What else can I help you with?
What amino acid is attached to the tRNA with the anti-codon 5'-GUC-3'?
The amino acid attached to the tRNA with the anti-codon 5'-GUC-3' is valine.
MRNA has codons or anti codons?
Great Question. The triplet Codon, as represented by the sequence of Dna bases, would appear to be inverted into anti-Codon form in the mRna molecule. This makes the triplet Codon on the transfer-Rna Codon form.
How do both the codon and the anticodon work together?
A codon is found on the mesenger RNA (mRNA) the anti codon is the exact opposite of a codon. so lets say your codon was G C A your anticodon would be C G U The codon and anti codon work together to help make strands of protein The codon is kind of like the code for what protein you need. transfer RNA (tRNA) collects free RNA nucleotides and brings them to the Ribosome to create an anti codon which brings a certain protein to the ribosome. Do with that information what you will.
The three bases on the tRNA molecule that are complementary to one of the mRNA codons are called the?
putos - what in the hell is putos? it sounds NASTY
In which molecule would you find an anti-codon?
an anti-codon is a code for an amino acid found on protein
Complementary of a codon?
anti-codon.
What is the difference between a coden and an anti coden?
a codon is the sequence of three nucleotides of mRNA, the anti codon is the amino acid of tRNA that is matched to the codon.
What is the name of the process where RNA codon is read and the tRNA anti-codon brings amino acids to the codon?
Transcription
What is the anti-codon for UGA?
The anti-codon for the mRNA codon UGA is ACU. In the context of tRNA, this sequence pairs with the codon during protein synthesis. However, it's important to note that UGA is a stop codon, meaning it signals the termination of protein synthesis and does not correspond to an amino acid.
Which type of RNA has the anti codon?
tRNA
What molecule contain anticodons?
The tRNA gene sequence is the anti-codon while mRNA is the codon sequence.
What amino acid is attached to the tRNA with the anti-codon 5'-GUC-3'?
The amino acid attached to the tRNA with the anti-codon 5'-GUC-3' is valine.
MRNA has codons or anti codons?
Great Question. The triplet Codon, as represented by the sequence of Dna bases, would appear to be inverted into anti-Codon form in the mRna molecule. This makes the triplet Codon on the transfer-Rna Codon form.
An anti-codon is part of a molecule of?
Transfer RNA. tRNA.
How many bases are in an anti-codon?
3 bases make up an anti-codon, 3 bases also make up a codon
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
How many bases in an anticondon?
Three. Like this. Codon: AUG anti-----UAC
