The anticodon is a sequence of the tRNA that compliments the matching t base pairs on the mRNA. The anticodon is an amino acid specific to the tRNA molecule.
The amino acid attached to the tRNA with the anti-codon 5'-GUC-3' is valine.
Great Question. The triplet Codon, as represented by the sequence of Dna bases, would appear to be inverted into anti-Codon form in the mRna molecule. This makes the triplet Codon on the transfer-Rna Codon form.
A codon is found on the mesenger RNA (mRNA) the anti codon is the exact opposite of a codon. so lets say your codon was G C A your anticodon would be C G U The codon and anti codon work together to help make strands of protein The codon is kind of like the code for what protein you need. transfer RNA (tRNA) collects free RNA nucleotides and brings them to the Ribosome to create an anti codon which brings a certain protein to the ribosome. Do with that information what you will.
putos - what in the hell is putos? it sounds NASTY
an anti-codon is a code for an amino acid found on protein
anti-codon.
a codon is the sequence of three nucleotides of mRNA, the anti codon is the amino acid of tRNA that is matched to the codon.
Transcription
The anti-codon for the mRNA codon UGA is ACU. In the context of tRNA, this sequence pairs with the codon during protein synthesis. However, it's important to note that UGA is a stop codon, meaning it signals the termination of protein synthesis and does not correspond to an amino acid.
tRNA
The tRNA gene sequence is the anti-codon while mRNA is the codon sequence.
The amino acid attached to the tRNA with the anti-codon 5'-GUC-3' is valine.
Great Question. The triplet Codon, as represented by the sequence of Dna bases, would appear to be inverted into anti-Codon form in the mRna molecule. This makes the triplet Codon on the transfer-Rna Codon form.
Transfer RNA. tRNA.
3 bases make up an anti-codon, 3 bases also make up a codon
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
Three. Like this. Codon: AUG anti-----UAC